| Protocol | TLR Signaling Screen |
| Author |
| Owen M. Siggs |
| Background |
The Toll-like receptors (TLRs), attentive to the molecular themes of microbial infection, constitute a key sensory apparatus of the innate immune system ( 1). Ten TLRs are present in man, twelve in mouse, with a total of thirteen between both species. The signaling capacity of seven of these are monitored in our screen (Table 1) through the ex vivo stimulation of thioglycolate-elicited peritoneal cells.
Table 1 | TLR Ligands.
|
Ligand
|
Receptor
|
Source
|
Catalogue No.
|
Stock Concentration
|
Screening Concentration
(min-max range)
|
Reference
|
|
LPS
|
TLR4
|
Alexis (San Diego, CA)
|
ALX-581-007
|
1 mg/mL
|
800 pg/mL
(50-1000 pg/mL)
|
|
|
poly(I:C)
|
TLR3
|
Alexis (San Diego, CA)
|
ALX-746-021
|
1 mg/mL
|
50 ug/mL
(5-100 mg/mL)
|
|
|
Pam3CSK4
|
TLR1/2
|
EMC (Tübingen, Germany)
|
L2000
|
1 mg/mL
|
30 ng/mL
(10-40 ng/mL)
|
|
|
Resiquimod
|
TLR7
|
Novartis/
Alexis (San Diego, CA)
|
ALX-420-038
|
100 mg/mL
|
30 ng/mL
(5-40 ng/mL)
|
|
|
CpG ODN
|
TLR9
|
IDT (San Diego, CA)
|
oligo sequence: TCCATGACGTTCCTGATGCT
|
10 mg/ml
|
15 ug/ml
|
|
|
Peptidoglycan
|
TLR2/6
|
Fluka (Seelze, Germany)
|
77140
|
2 mg/mL
|
1 ug/mL
(50-800 ng/mL)
|
|
|
MALP-2
|
TLR2/6
|
Alexis (San Diego, CA)
|
ALX-162-027
|
100 ug/mL
|
1.8 ng/mL
(5-50 pg/mL)
|
|
TLRs are potent inducers of the proinflammatory cytokine tumor necrosis factor alpha (TNFα), and to this end TNF is used as our screening endpoint. Bioactive TNF (α and β) is measured by virtue of its cytotoxicity towards the mouse fibroblast line, L-929 (9) (American Type Culture Collection: CCL-1), and since TNFβ expression is restricted to lymphoid cells, all TNF bioactivity derived from purified macrophages will be due to TNFα. L-929 viability is determined by the addition of the yellow tetrazolium salt, 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT), which is reduced to a purple formazan product through cleavage of the tetrazolium ring. Since this reaction occurs only in the mitochondria of live cells, viability may be inferred colorimetrically (10). |
| Reagents and Solutions |
Brewer’s thioglycolate medium, 4%
4% (w/v) Brewer’s thioglycolate medium powder (BBL Microbiology Systems, Cockeysville, MD) is added to distilled water pre-warmed to 37°C. Solution is autoclaved to sterilize and stored away from light.
PEC recovery solution
Hepes-buffered saline solution (Gibco, Invitrogen, Carlsbad, CA )
5% (v/v) heat-inactivated fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA)
200 IU/mL penicillin (Gibco)
200 mg/mL streptomycin (Gibco)
PEC medium
Dulbecco’s modified eagle medium (Mediatech Inc., Herndon, VA)
5% (v/v) heat-inactivated fetal bovine serum
200 IU/mL penicillin
200 mg/mL streptomycin
L-929 medium
Dulbecco’s modified eagle medium
10% (v/v) heat-inactivated fetal bovine serum
200 IU/mL penicillin
200 mg/mL streptomycin
Cycloheximide solution
10mg/mL cycloheximide (Sigma) in sterile PBS, and diluted 1:25 in L-929 medium immediately prior to use.
MTT solution
2mg MTT (Sigma)/mL sterile PBS.
Lysis solution
90% (v/v) isopropanol
0.5% (w/v) SDS
0.04N HCl
Adjust volume with distilled water. |
| Method |
Peritoneal exudate cell (PEC) isolation
- Three to four days prior to PEC isolation, 5mL syringes filled with Brewer’s thioglycolate medium are used to inject mice intraperitoneally with 1.5-2mL through a 25-gauge needle.
- Immediately prior to isolation, mice are anaesthetized under isofluorane vapour (2-5% v/v, 2% O2).
- 5mL syringes filled with sterile PBS are used to recover PECs by lavage through an 18-gauge needle. Once obtained, exudate is added to 5mL of PEC recovery solution in a 15mL conical tube, and stored on ice.
- Tubes containing exudate are centrifuged for 5 minutes at 1500 rpm in a tabletop centrifuge, and supernatant is replaced with 1mL of PEC medium. Pelleted cells are resuspended by pipeting, and a 20μL aliquot is taken for cell enumeration.
- The concentration of each cell sample is adjusted to 1x106 cells/mL using PEC medium, and 50μL of each sample (5x104 cells) is added to duplicate columns of a tissue culture-treated 96 well flat-bottomed plate, leaving two columns (11 & 12) unoccupied per plate (Table 2). Plates are incubated at 37oC/5%CO2 in a humidified incubator for at least 30 minutes to allow cells to adhere to the plate, during which time TLR ligand solutions are prepared.
Activation with TLR ligands
- TLR ligand solutions are prepared at predetermined concentrations in PEC medium, using the minimum concentration necessary to elicit a maximal TNFα response by L-929 bioassay (Table 1).
- Following preincubation of PECs in the 96 well plate, non-adherent PECs are discarded along with residual medium, and 100μL of each TLR ligand solution is added to each well of the corresponding row (Table 2). Plates are incubated for a further 4 hours.
- Conditioned supernatant is collected into another 96 well plate, and replaced with 100μL/well of a 1:4 MTT solution:PEC medium solution (MTT 400mg/mL final concentration). PEC plates are incubated at 37oC/5%CO2 overnight, and conditioned supernatant retained for TNF bioassay.
Table 2 | 96 well plate layout.
|
|
|
sample 1
|
sample 2
|
sample 3
|
sample 4
|
sample 5
|
TNFα
|
|
|
|
1
|
2
|
3
|
4
|
5
|
6
|
7
|
8
|
9
|
10
|
11
|
12
|
|
LPS
|
A
|
|
|
|
|
|
|
|
|
|
|
|
|
|
poly(I:C)
|
B
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Pam3CSK4
|
C
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Resiquimod
|
D
|
|
|
|
|
|
|
|
|
|
|
|
|
|
CpG
|
E
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Peptidoglycan
|
F
|
|
|
|
|
|
|
|
|
|
|
|
|
|
MALP-2
|
G
|
|
|
|
|
|
|
|
|
|
|
|
|
|
medium
|
H
|
|
|
|
|
|
|
|
|
|
|
|
|
TNF bioassay
- On the day prior to bioassay, 5x104 L-929 cells are added to every well of a tissue culture-treated 96 well flat-bottomed plate in a volume of 100μL L-929 medium, and incubated overnight at 37oC/5%CO2.
- Immediately prior to bioassay, supernatant is replaced with 50μL/well of cycloheximide solution, and incubated at 37oC/5%CO2 for at least 20 minutes.
- A mouse recombinant TNFα (ALX-522-009, Alexis, San Diego, CA) standard series is prepared in the interim, using 7 serial two-fold dilutions (starting from ~50pg/mL) and L-929 medium alone. 50μL of each standard point is added in duplicate to columns 11 & 12 of each L-929 plate (organized as in Table 2), and 50μL of L-929 medium alone to rows 1-10. Finally, 5mL of conditioned PEC medium is added to the corresponding wells of each L-929 plate, and plates are incubated at 37oC/5%CO2 for 12-16 hours.
- Following incubation, 25μL/well of MTT solution (400mg/mL final concentration) is added to the L-929 plates, which are then incubated at 37oC/5%CO2 for an additional hour.
- Supernatant from all plates (L-929 and PEC) is discarded and replaced with 80μL/well lysis solution, then incubated at room temperature for 30 minutes to allow the purple formazan precipitate to enter solution.
Absorbance at 590 nm is read. For L-929 plates, bioactive TNF concentrations are inferred from the standard curve of [TNFα] versus absorbance. For PEC plates, the absorbance values provide an indication of the number of live cells used in the TNF assay. To adjust for sample to sample variation in PEC number (which may affect the amount of TNFα produced), the calculated TNF concentrations must be normalized. Average absorbance of each PEC sample (e.g. average absorbance of columns 1 and 2, 3 and 4, 5 and 6, etc. on PEC plate) is divided by the total average absorbance across all PEC plates. The resulting figure is used to normalize each TNF concentration value. Typically, samples falling outside three standard deviations of the mean are considered putative mutants, and leftover PEC solution may be used for ligand dose-response retesting. |
| Critical Parameters and Troubleshooting |
Thioglycolate preparation
Thioglycolate solution should be carefully prepared to ensure maximal PEC recovery. Solvent should be warmed to 37°C prior to solute addition to assist solubility, and subsequently autoclaved at least once, since this increases inflammatory potential ( 11). Aging the solution for at least 1 month also enhances activity ( 12), in which case it should be stored away from light and at room temperature.
Ligand contamination
Upon receipt, new ligand stock should immediately be distributed into individual aliquots and stored at -70°C. Each ligand should then be tested for purity using PECs from mice deficient in the corresponding TLR, to ensure that no TNF is produced in its absence.
L-929 cell renewal
Once received from source, L-929 cells should first be tested for sensitivity to TNF. Once confirmed, sensitive cells should be expanded and stored in liquid nitrogen in multiple aliquots. Since L-929 cells lose their sensitivity to TNF over time, these aliquots may be thawed as required.
Retesting
While stimulated PEC supernatants may be stored indefinitely at -20°C, PECs stored at 4°C remain viable and responsive to TLR stimulation for up to four days. Prompt completion of the initial L-929 bioassay therefore allows any remaining cells to be used for confirmation of putative mutants. A minimum of three weeks should be allowed between thioglycolate injections to allow for sufficient PEC recovery. |
| Alleles Identified |
|
effete
feckless
millais
sinecure
Spacey
|
| References |
1. Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic analysis of host resistance: Toll-Like receptor signaling and immunity at large, Annu. Rev. Immunol. 24, 353-389.
2. Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282, 2085-2088.
4. Takeuchi, O., Sato, S., Horiuchi, T., Hoshino, K., Takeda, K., Dong, Z., Modlin, R. L., and Akira, S. (2002) Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins, J. Immunol. 169, 10-14.
5. Hemmi, H., Kaisho, T., Takeuchi, O., Sato, S., Sanjo, H., Hoshino, K., Horiuchi, T., Tomizawa, H., Takeda, K., and Akira, S. (2002) Small anti-viral compounds activate immune cells via the TLR7 MyD88- dependent signaling pathway, Nat. Immunol. 3, 196-200.
6. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA, Nature 408, 740-745.
7. Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K., and Akira, S. (1999) Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components, Immunity 11, 443-451.
8. Takeuchi, O., Kawai, T., Muhlradt, P. F., Morr, M., Radolf, J. D., Zychlinsky, A., Takeda, K., and Akira, S. (2001) Discrimination of bacterial lipoproteins by Toll-like receptor 6, Int. Immunol. 13, 933-940.
9. Carswell, E. A., Old, L. J., Kassel, R. L., Green, S., Fiore, N., and Williamson, B. (1975) An endotoxin-induced serum factor that causes necrosis of tumors, Proc. Natl. Acad. Sci. ,USA 72, 3666-3670.
|