Home Phenotypic Mutations Incidental Mutations Protocols FAQ Mutation Stats About Contact Links Request Mice

Click here to save record as a PDF

Protocol

Double-stranded DNA Macrophage Screen

Author
Owen M. Siggs
Background

As in our Toll-like Receptor (TLR) signaling screen, stimulated ex vivo thioglycolate-elicited peritoneal cells are used to discover components involved in sensing cytoplasmic double-stranded DNA (dsDNA).  While a non-redundant cytoplasmic sensor remains to be found, dsDNA is known to induce production of type I interferon through a TANK-binding kinase 1 (TBK1)-, inhibitor of NF-κB kinase ε (IKKε)-, and interferon regulatory factor 3 (IRF3)-dependent pathway (1;2).  This occurs independently of TLR signaling.  The dsDNA macrophage screen is designed to probe for additional components of this pathway by isolating macrophages from N-ethyl-N-nitrosourea (ENU)-mutagenized mice, stimulating them with dsDNA and assaying the production of type I interferon.

Reagents and Solutions
Brewer’s thioglycolate medium, 4%
4% (w/v) Brewer’s thioglycolate medium powder (BBL Microbiology Systems, Cockeysville, MD) is added to distilled water pre-warmed to 37°C. Solution is autoclaved to sterilize and stored away from light.
 
PEC recovery solution
Hepes-buffered saline solution (Gibco, Invitrogen, Carlsbad, CA )
5% (v/v) heat-inactivated fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA)
200 IU/mL penicillin (Gibco)
200 mg/mL streptomycin (Gibco)
 
PEC medium
Dulbecco’s modified eagle medium (Mediatech Inc., Herndon, VA)
5% (v/v) heat-inactivated fetal bovine serum
200 IU/mL penicillin
200 mg/mL streptomycin
 
L-929 medium
Dulbecco’s modified eagle medium
10% (v/v) heat-inactivated fetal bovine serum
200 IU/mL penicillin
200 mg/mL streptomycin
 
Cycloheximide solution
10mg/mL cycloheximide (Sigma) in sterile PBS, and diluted 1:25 in L-929 medium immediately prior to use.
 
MTT solution
2mg MTT (Sigma)/mL sterile PBS.
 
Lysis solution
90% (v/v) isopropanol
0.5% (w/v) SDS
0.04N HCl
Adjust volume with distilled water.
 
dsDNA (IDT, San Diego, CA)
TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA duplex, 1μg/μL stock.
 
L-929 cells (ATCC #CCL-1)
 
OptiMEM (Gibco)
 
Lipofectamine 2000 (Invitrogen, Carlsbad, CA)
 
IFNβ standards (eBioscience, San Diego, CA, cat #14-8311-63)
 
Reporter Lysis buffer (Promega, Madison, WI)
 
Luciferase Assay System solution (Promega)
Method
Peritoneal exudate cell (PEC) isolation
  1. Three to four days prior to PEC isolation, 5mL syringes filled with Brewer’s thioglycolate medium are used to inject mice intraperitoneally with 1.5-2mL through a 25-gauge needle.
  2. Immediately prior to isolation, mice are anaesthetized under isofluorane vapour (2-5% v/v, 2% O2).
  3. 5mL syringes filled with sterile PBS are used to recover PECs by lavage through an 18-gauge needle. Once obtained, exudate is added to 5mL of PEC recovery solution in a 15mL conical tube, and stored on ice.
  4. Tubes containing exudate are centrifuged for 5 minutes at 1500 rpm in a tabletop centrifuge, and supernatant is replaced with 1mL of PEC medium. Pelleted cells are resuspended by pipeting, and a 20μL aliquot is taken for cell enumeration.
  5. The concentration of each cell sample is adjusted to 1x106 cells/mL using PEC medium, and 50μL of each sample (5x104 cells) is added to duplicate columns of a tissue culture-treated 96 well flat-bottomed plate, leaving two columns (11 & 12) unoccupied per plate (Table 2). Plates are incubated at 37oC/5%CO2 in a humidified incubator for at least 30 minutes to allow cells to adhere to the plate.
Activation with dsDNA
  1. Following preincubation of PECs in the 96 well plate, non-adherent PECs are discarded along with residual medium, and 100μL of OptiMEM is added to all wells apart from those in columns 11 & 12. Plates are incubated at 37oC/5%CO2.
  2. 0.1μg dsDNA is mixed with 25μL OptiMEM medium per well to be assayed (11.5uL dsDNA in 2875μL OptiMEM/plate) and mixed gently.
  3. 0.25μL Lipofectamine 2000 is mixed with 25μL OptiMEM medium per sample to be assayed (28.75μL Lipofectamine in 2875μL OptiMEM/plate), mixed gently and incubated at room temperature for five minutes.
  4. Lipofectamine and dsDNA solutions are gently mixed in one tube, and incubated at room temperature for twenty minutes.
  5. 50μL of Lipofectamine/dsDNA mix is added to all sample wells of the 96 well plate, and plates are incubated overnight for ~16 hours.
  6. Following incubation, supernatant is transferred into a new 96 well plate until used in the type 1 interferon bioassay (3b), and replaced with 100μL/well of MTT solution in PEC medium, and incubated overnight at 37oC/5%CO2.
Table 1 | Type 1 interferon ELISA plate layout
 
 
 
 
 
 
 
 
IFNβ
 
 
1
2
3
4
5
6
7
8
9
10
11
12
 
A
sample 1
sample 2
sample 3
sample 4
sample 5
100
 
B
sample 6
etc.
 
 
 
 
 
 
50
 
C
 
 
 
 
 
 
 
 
 
 
25
 
D
 
 
 
 
 
 
 
 
 
 
12.5
 
E
 
 
 
 
 
 
 
 
 
 
6.25
 
F
 
 
 
 
 
 
 
 
 
 
3.125
 
G
 
 
 
 
 
 
 
 
 
 
1.6125
 
H
 
 
 
 
 
 
 
 
 
 
0
 
Type 1 IFN bioassay
  1. On the day prior to bioassay, 5x104 L-929-ISRE cells are added to every well of a white, tissue culture-treated 96 well flat-bottomed plate in a volume of 100μL L-929 medium, and incubated overnight at 37oC/5%CO2.
  2. A mouse recombinant IFNβ standard series is prepared immediately prior to bioassay, using 7 serial two-fold dilutions (starting from ~100U/mL) and L-929 medium alone. 100μL of each standard point is added in duplicate to columns 11 & 12 of each L-929-ISRE plate (organized as in Table 1),
  3. Immediately prior to bioassay, the supernatant of L-929-ISRE cells is discarded and replaced with 75μL of PEC-conditioned media, and incubated at 37oC/5%CO2 for 6-8 hours.
  4. Following incubation, supernatant is discarded and plates are washed once with 200μL/well PBS.
  5. PBS is then discarded, and 30μL/well reporter lysis buffer is added.
  6. Plates are incubated at -70oC for greater than one hour.
  7. After plates have thawed, 50μL/well of Luciferase Assay System solution is added, and luminescence read immediately.

Bioactive type 1 IFN concentrations are inferred from the standard curve of [IFNβ] versus ISRE-dependent luminescence.  For PEC plates, the absorbance values provide an indication of the number of live cells used in the IFN bioassay.  To adjust for sample to sample variation in PEC number (which may affect the amount of IFN produced), the calculated IFN concentrations must be normalized.  Average absorbance of each PEC sample (e.g. average absorbance of columns 1 and 2, 3 and 4, 5 and 6, etc. on PEC plate) is divided by the total average absorbance across all PEC plates.  The resulting figure is used to normalize each IFN concentration value.  Typically, samples falling outside three standard deviations of the mean are considered putative mutants, and leftover PEC solution may be used for ligand dose-response retesting.

 
Critical Parameters and Troubleshooting
Thioglycolate preparation
Thioglycolate solution should be carefully prepared to ensure maximal PEC recovery.  Solvent should be warmed to 37°C prior to solute addition to assist solubility, and subsequently autoclaved at least once, since this increases inflammatory potential (3).  Aging the solution for at least 1 month also enhances activity (4), in which case it should be stored away from light and at room temperature.
 
L-929 cell renewal
Once received from source, L-929 cells should first be tested for sensitivity to IFNβ.  Once confirmed, sensitive cells should be expanded and stored in liquid nitrogen in multiple aliquots.  Since L-929 cells lose their sensitivity to IFNβ over time, these aliquots may be thawed as required.
 
Retesting
While stimulated PEC supernatants may be stored indefinitely at -20°C, PECs stored at 4°C remain viable and responsive to stimulation for up to four days.  Prompt completion of the initial assay therefore allows any remaining cells to be used for confirmation of putative mutants.  A minimum of three weeks should be allowed between thioglycolate injections to allow for sufficient PEC recovery.

 

Alleles Identified
millais
References