| Gene Symbol | Tlr6 |
|---|---|
| Gene Name | Toll-like receptor 6 |
| Synonym(s) | |
| Accession Number | |
| Allele | insouciant |
| Institutional Source | Beutler Lab |
| Mapped | Yes |
| Chromosome | 5 |
| Chromosomal Location | 65.344-65.351 Mb (-) |
| Type of Mutation | MISSENSE |
| DNA Base Change (Sense Strand) |
T to C at 65345822 bp |
| Amino Acid Change | Valine changed to Alanine |
| Phenotypic Category | immune system, TLR signaling defect- TNF production by macrophages |
| Penetrance | 100% |
| Alleles Listed at MGI | All alleles(5) : Targeted, knock-out(1) Chemically induced(4) |
| Beutler Lab Alleles | |
| Mode of Inheritance | Autosomal Recessive |
| Local Stock | Live Mice, Embryos, gDNA |
| Repository | MMRRC: 010474-UCD |
| Last Updated | 02/03/2010 9:42 AM by Nora G. Smart |
| Record Created | unknown |
| Record Posted | 10/16/2007 |
| Phenotypic Description | The insouciant phenotype was identified in a G3 screen for mutants with altered response to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1). Peritoneal macrophages from insouciant mice fail to produce tumor necrosis factor (TNF)-α in response to peptidoglycan, lipoteichoic acid and MALP-2 (macrophage-activating lipopeptide-2), all lipopeptides that activate the TLR2/6 heterodimer complex . Zymosan is also a TLR2/6 ligand, but it could partially activate insouciant macrophages to produce TNF-α; contamination from TLR2-independent ligands is suspected. The diacyl lipopeptide Pam2CSK4 also elicited a partial response. In contrast, TNF-α production is normal in response to Pam3CSK4 (triacyl lipopeptide), lipopolysaccharide (LPS), ssDNA (CpG-DNA), resiquimod, and dsRNA (poly I:C) (Figure 1 and data not shown). Phosphorylation of c-JUN N-terminal kinase (JNK), extracellular signal-regulated kinase (ERK) and IκB in response to MALP-2 was greatly reduced in insouciant macrophages.
|
| Nature of Mutation | Because the insouciant phenotype is almost identical to that of Tlr6-/- mice, Tlr6 (Chromosome 5) from insouciant mice was sequenced. A Tlr6 mutation corresponding to a T to C transition at position 1112 of the Tlr6 transcript, in exon 2 of 2 total exons, was identified.1095 CACGTCAAAAACCAAGTGTTCCTCTTTTCAAAG
322 -H--V--K--N--Q--V--F--L--F--S--K-
The mutated nucleotide is indicated in red lettering, and results in a conversion of valine to alanine at residue 327 of the TLR6 protein. |
| Protein Prediction | TLR6 is an 806-amino acid type I transmembrane glycoprotein receptor (2). TLR6 is most similar to TLR1, sharing 69% overall amino acid identity and 81% similarity (2). TLR6 and TLR1 each heterodimerize with TLR2 to form receptors for distinct ligand types (diacyl lipopeptides for TLR6, triacyl lipopeptides for TLR1). Like the other TLRs, the TLR6 cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2), which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (3). In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (4;5). The crystal structures of the TLR1 and TLR2 TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (5) (see the record for languid). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4 (see record for lps3), which abolishes MyD88 binding (6) and LPS-induced signaling in mice (7).
The N-terminus of TLR6 contains a signal peptide followed by an extracellular domain containing twenty tandem leucine-rich repeats (LRRs) and a transmembrane domain. LRR domains, which mediate ligand recognition by TLRs, consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) and XØXXØX4FXXLX (variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (8)]. Crystal structures of TLR1, TLR2 (9) and other LRR-containing proteins revealed that the XLXXLXLXX sequence folds into a β-strand (8). Each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (8). The structure of TLR6 was modeled using the structure of TLR1 as a template, and its analysis suggests that unlike TLR1 in the TLR2/1 heterodimer, no lipid-binding pocket exists in TLR6 (9). In TLR1, this channel accommodates one of the acyl chains of Pam3CSK4 (the others bind in a pocket in TLR2) (9). The presence of phenylalanine in place of Met338 and Leu360 in TLR6 is predicted to block such a lipid channel in TLR6, providing the basis of TLR2/6 specificity for diacylated versus triacylated lipopeptides (9). Discrimination between diacylated and triacylated lipopeptides has previously been attributed to LRR modules 9-12 of TLR6 and TLR1 (10), in agreement with the crystal structure (9).The insouciant mutation substitutes an alanine for valine at position 327 of TLR6 (Figure 2; PDB ID 2Z7X). This valine, and the six amino acids surrounding it, are conserved in both human and mouse TLR6 (2). A stretch of about 50 amino acids including valine 327 forms the TLR1 or TLR6 dimer interface with TLR2. The structure of the TLR2/1 heterodimer shows that the corresponding valine in TLR1 participates in hydrophobic interactions with TLR2 at the dimer interface, as well as making contacts with the ligand (9). However, because diacylated TLR2/6 ligands do not bridge these two receptors through precisely the same mechanism as triacylated ligands would for TLR2/1, the authors of the study propose that the structure of the dimer interface of TLR2/6 is likely to differ from that of TLR2/1. Their model of the TLR6 structure does not predict direct participation of valine 327 in the dimer interface, although the adjacent glutamine is indicated to form either hydrogen or ionic bonds with TLR2 (9). Because of its position at the center of the dimer interface, although perhaps not in direct contact with TLR2, the valine mutated in insouciant may be hypothesized to disrupt heterodimerization between TLR2 and TLR6 and prevent signaling from this receptor complex. |
| Expression/Localization | Tlr6 transcript is detected by RT-PCR in mouse thymus, spleen, ovary and lung (2). No expression is detected in liver, kidney and heart (2). TLR6 has been demonstrated to localize and function at the cell membrane (11). However, TLR2, its obligate binding partner, can be recruited to and activated by ligands in macrophage phagosomes, suggesting that TLR6 may also be found in phagosomes (12). |
| Background | TLRs are transmembrane receptors that sense molecules of microbial origin and trigger host cell responses. There are 12 TLRs in mice, and 10 in humans; each receptor recognizes one or more distinct microbial ligands. Together with TLR1 or TLR6, TLR2 recognizes a wider range of ligands than other TLRs, including lipopeptides, lipoteichoic acids (LTA), lipoarabinomannan and zymosan (13). Studies of TLR-deficient mice revealed that TLR1 specifies recognition of triacyl lipopeptides (14), while TLR6 predominantly recognizes diacyl lipopeptides (15). However, some diacyl lipopeptides, such as Pam2CSK4, are recognized by TLR6-deficient cells (in a TLR2-dependent manner), suggesting that a TLR2 homodimer or a new heterodimer may recognize some lipopeptide species, and/or that other characteristics than the absence of a long chain amide-bound fatty acid can specify TLR2/6 ligands (16;17). Evidence suggests that the amino acid sequence of the lipopeptide also contributes to its recognition by TLR2/6 or TLR2/1 (16-18).
Upon ligand binding, the activated TLR2 heterodimer transduces the signal through the adapter proteins MyD88 and TIRAP (TIR-domain-containing adaptor protein), which recruit and activate several IRAKs (IL-1-receptor-associated kinases) and TRAF6 (tumor necrosis factor receptor-associated factor 6) [reviewed in (13;19)] (Figure 3). Their functions lead to the activation of the IKK (IκB kinase) complex, which phosphorylates IκB, leading to the liberation of NF-κB for translocation to the nucleus and transcriptional activation. MAP kinase may also be activated through TRAF6; it controls AP-1 regulated gene expression. Transcriptional activation of cytokines, including TNF and IL-6, results in the initiation of a local inflammatory response.Study of the Cd36obl/obl (oblivious) mouse mutant demonstrated that the Cd36 receptor is required for TLR2/6-dependent detection of certain lipopeptides (20). Oblivious macrophages exhibit reduced TNF-α production in response to the diacyl lipopeptides MALP-2 and LTA (both TLR2/6 ligands), but normal TNF-α production stimulated by peptidoglycan, zymosan and Pam3CSK4 (20). Cd36obl/obl mice, like TLR2-deficient mice, are also highly susceptible to infection by Staphylococcus aureus (20;21). Cd36 has been implicated in phagocytosis of Staphylococcus aureus and LTA, and the subsequent activation of TLR2/6 (22). Thus, while the nature of their interaction is unknown, Cd36 is a co-receptor for TLR2/6 heterodimer recognition of certain diacyl lipopeptide ligands. |
| Putative Mechanism | As described above (Protein Prediction), the insouciant mutation is predicted to disrupt the dimerization interface between TLR6 and TLR2, preventing signaling stimulated by diacyl lipopeptides but leaving intact triacyl lipopeptide signaling mediated by TLR2/1. The mutation replaces a conserved valine at the core of the dimerization interface (9). |
| Genotyping | Insouciant genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
Primers for PCR amplification
Ins(F): 5’-CTTCAGATTCCCAATACCACCGTTCTC -3’
Ins(R): 5’-GCATCTTGATGTTCATCTCAGCAAACAC -3’
PCR program
1) 94°C 2:00
2) 94°C 0:15
3) 60°C 0:20
4) 68°C 1:00
5) repeat steps (2-4) 35X
6) 68°C 5:00
7) 4°C ∞
Primers for sequencing
Ins_seq(F): 5’- CCAATACCACCGTTCTCCATTTG -3’
Ins_seq(R): 5’- ATGTTCATCTCAGCAAACACCGAG -3&rsquo>
The following sequence of 436 nucleotides (from Genbank genomic region NC_000071 for linear genomic DNA sequence of Cd14) is amplified:
5076 cttca gattcccaat accaccgttc
5101 tccatttggt ctttcatcca aatagcttgt tctctgttca agtgaacatg tctgtaaacg
5161 ctttaggaca tttacaactg agtaatatta aattgaatga tgaaaactgt caaaggttaa
5221 tgacattttt atcagaactc accagaggtc caaccttatt gaatgtgacc ctccagcaca
5281 tagaaacaac ctggaagtgc tcggttaaac ttttccaatt cttttggccc cgaccggtgg
5341 agtacctcaa tatttacaac ttaacgataa ctgagagaat cgacagggaa gaatttactt
5401 actcggagac agcactgaag tcactgatga tagagcacgt caaaaaccaa gtgttcctct
5461 tttcaaagga ggcgctatac tcggtgtttg ctgagatgaa catcaagatg c
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text. |
| References | |
| Science Writers | Eva Marie Y. Moresco |
| Authors | Zhengfan Jiang, Bruce Beutler |