Beutler Lab Website

Strains @ MMRRC

Display Strains By

Search Mutagenetix



Staff Login

save as PDF

Gene Symbol Ptpn6
Gene Name protein tyrosine phosphatase, non-receptor type 6
Synonym(s) hcp, Hcph, Ptp1C, SHP-1
Accession Number

Genbank: NM_013545; MGI: 96055

Allele spin
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 6
Chromosomal Location 124.671-124.683 Mb (-)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
T to A at 124678577 bp
Amino Acid Change Tyrosine changed to Asparagine
Phenotypic Category hematopoietic system, immune system
Penetrance 90% (inflammatory phenotype on C57BL/6J background at 10-25 weeks of age) 
Alleles Listed at MGI

All alleles(6) : Targeted, other(1) Gene trapped(1) Spontaneous(3) Chemically induced(1)

Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
Repository

MMRRC: 015198-UCD

Last Updated 02/03/2010 3:09 PM by Eva Marie Y. Moresco
Record Created unknown
Record Posted 08/20/2008
Phenotypic Description
The spin (for spontaneous inflammation) phenotype was identified among ENU-mutagenized G3 mice (1).  Homozygous spin mice develop inflamed, raw, weeping lesions on the plantar surfaces of the feet by 6 weeks of age (Figure 1A).  The penetrance of this visible phenotype is 90% in both males and females on a pure C57BL/6 background when scored between 10 and 25 weeks. Histological examination of tissue sections from the feet of spin mice reveal a thickening of the epidermis, microabscesses in the epidermal and dermal layers, bone marrow hyperplasia, and a mononuclear infiltrate in the dermal layer (Figure 1B).  Mixed inflammatory infiltrates are also observed in the salivary glands and lungs.
 
Before 5 weeks of age, spin homozygotes show no signs of foot inflammation, and have normal frequencies and total numbers of myeloid and erythroid cells in the bone marrow, spleen and peripheral blood. The appearance of foot lesions by 6 weeks of age is associated with the development of splenomegaly and an increased number of erythroid and myeloid cells in the spleen, as well as a reduction in mature B cell numbers in the peripheral blood, spleen and bone marrow. Spin homozygotes have elevated levels of serum polyclonal IgM, and anti-chromatin IgM and IgG. Bone marrow transplantation between spin homozygotes and wild type congenic C57BL/6J Ly5.1+ mice demonstrates that the inflammatory phenotype is conferred by hematopoietic precursors.
 
Homozygous spin mice display increased resistance to infection by Listeria monocytogenes, as evidenced by reduced bacterial burden and enhanced survival relative to wild type controls after infection with sublethal (105 cfu) or lethal (5 x 105 or 106 cfu) doses. Spin mice display normal resistance to mouse cytomegalovirus (MCMV) and normal natural killer (NK) cell function in vivo. Peritoneal macrophages from spin homozygotes produce normal levels of tumor necrosis factor (TNF)-α in response to poly I:C, Pam3CSK4 and lipopolysaccharide (LPS), ligands for Toll-like receptor 3 (TLR3), TLR2/1 and TLR4, respectively. Pro-IL-1β production, the degradation of IκB, and the phosphorylation of MAP kinases p38, p42, and p44 is also normal in macrophages stimulated with LPS.
 
The constant exposure of the feet to microbial stimuli together with the predominant localization of inflammation to the feet of spin mice suggested a pathogenic mechanism that might cause the inflammatory response in these animals. Compound homozygotes, combining MyD88poc, Irak4otiose, or Ticam1Lps2 with spin were created to test the involvement of TLR signaling in the inflammatory phenotype (although it is also known that MyD88 mediates signaling from IL-1/IL-18/IL-33 receptors). Combining a MyD88-inactivating mutation with spin completely suppressed the development of foot inflammation and the elevation of serum IgM and anti-chromatin IgM and IgG, demonstrating that MyD88 is required for the chronic inflammatory and autoimmune phenotypes caused by the spin mutation. IRAK4 is required for MyD88-dependent signaling, while TICAM1 (TRIF) is required for MyD88-independent signaling. IRAK4 deficiency suppressed inflammation in spin mice, but TICAM1 deficiency did not. MyD88-dependent (but not MyD88-independent) signaling is thus required for the development of chronic plantar inflammation caused by the spin mutation. MyD88 signaling elicits interferon (IFN), TNF, and IL-1 production, all of which may initiate signaling that contributes to chronic inflammation and autoimmunity.  However, compound homozygosity for an inactivating mutation of STAT1 (domino), which blocks IFN signaling, and spin failed to suppress inflammation. Compound homozygosity for spin and a null allele of Tnf also failed to suppress inflammation. In contrast, inflammation was fully suppressed in spin/spin Il1r1-/- mice that lack IL-1α and IL-1β signaling.
 
MyD88 signaling may be activated by endogenous molecules, and by microbial signature molecules detected by TLRs. To determine whether microbes drive the inflammatory phenotype in spin mice, several homozygous spin mice were derived into a germ-free environment before the onset of inflammation by Caesarian section in near term females. In the absence of normal commensal flora, the phenotype was fully suppressed. Histological analysis revealed no lesions in the feet, kidneys, liver, lungs, lymph nodes, pancreas and salivary glands of spin homozygotes. Total serum IgM, IgG, and anti-chromatin antibody levels were also comparable between germ-free spin homozygotes and germ-free control mice. When two germ-free spin mice without inflammation were conventionalized into standard housing conditions, both developed plantar inflammation, as well as increased levels of serum IgM, IgG, and anti-chromatin antibodies. The chronic inflammation and autoimmunity of spin mice are therefore not dependent upon developmental context but upon the presence of microbes introduced during postnatal life.

 

Nature of Mutation
The spin mutation was mapped to Chromosome 6, and corresponds to a T to A transversion at position 814 of the Ptpn6 transcript, in exon 5 of 16 total exons.
 
799 TCGGGTGCCTTTGTCTACCTGCGGCAGCCTTAC
203 -S--G--A--F--V--Y--L--R--Q--P--Y-
 
The mutated nucleotide is indicated in red lettering, and results in the substitution Y208N. 
 
The spin mutation failed to complement the classical Ptpn6 mutant allele, viable motheaten (me-v), confirming that spin and me-v mice harbor mutations in the same gene.
Protein Prediction
Ptpn6 encodes SHP1, a Src-homology 2 (SH2) domain-containing cytoplasmic protein tyrosine phosphatase. SHP1 has 4 isoforms. Three isoforms of SHP1 contain variations in their N-termini; the fourth isoform is a longer form with an extended C-terminus. SHP1 contains two tandem N-terminal SH2 domains (residues 1-108 and 116-208), a central catalytic domain (residues 270-532), and a C-terminal tail (Figure 2) [(2), discussed in (3)]. The C-terminal tail contains multiple sites for tyrosine and serine phosphorylation, by which the protein’s signaling properties are regulated. SHP1 normally exists in an autoinhibited conformation that must be opened and activated by binding partners. The crystal structure of SHP1 suggests a model of activation in which the C-terminal SH2 (C-SH2) domain functions as an “antenna” to search for phosphopeptide binding partners (2). Engagement of the C-SH2 domain would lead to a conformational change in the N-terminal SH2 (N-SH2) domain, opening its phosphopeptide-binding pocket to ligands. Together, binding of both SH2 domains to partners destabilizes the autoinhibited conformation of SHP1, in particular the interaction between the N-SH2 and catalytic domains, resulting in opening of the active site (2).
 
The binding specificity of phosphotyrosine-containing proteins for the SH2 domains of SHP proteins is known to depend critically on the three residues C-terminal to the phosphotyrosine (designated pY+1 to pY+3) (4;5). The spin mutation is a tyrosine to asparagine change at position 208, in the C-terminal SH2 domain, specifically in the BG loop of the protein that contributes to binding to pY+1 and pY+3 residues of binding partners (Figure 3, PDB ID 2B3O). Based on crystallographic studies and mutational analysis of the highly similar SHP1 and SHP2 proteins, the N-terminal SH2 domain is thought to undergo a conformational change that physically unblocks the catalytic domain upon engagement, allowing phosphatase activation (2;6;7). The C-terminal SH2 domain is not required for this disinhibition, but its presence is indispensable for optimal SHP signaling, and it has been proposed to aid in recruitment of binding partners. Futher studies will be required to determine whether the protein encoded by Ptpn6spin displays impaired or altered binding partner recruitment and/or failure to become optimally activated.  No differences in SHP1 protein levels were observed between C57BL/6J and spin macrophages when either untreated or stimulated with LPS.
Expression/Localization
SHP1 is most highly expressed in hematopoietic cells. SHP1 is normally cytoplasmic, but reportedly translocates to the nucleus upon cytokine stimulation in a murine pre-B cell line (8). SHP1 is targeted to lipid rafts by a 6-amino acid targeting motif in the C-terminus (9;10).
Background
The physiological functions of SHP1 have been illuminated by the study of the spontaneously occurring motheaten (me) and viable motheaten (me-v) mutants. The me-v allele encodes a protein with approximately 20% of wild type SHP1 phosphatase activity, while me is a null allele (11;12). Both me and me-v mice are immunodeficient and exhibit multiple defects stemming from increased inflammation, including alopecia, glomerulonephritis, dermatitis, inflammation of the paws, and interstitial pneumonitis which ultimately causes death by 3 and 9 weeks of age in Ptpn6me/me and Ptpn6me-v/me-v mice, respectively [(13;14); reviewed in (15)]. There is overproduction and accumulation of macrophages and neutrophils in the lungs, skin and extremities. Both strains develop autoimmunity, evidenced by elevated levels of serum immunoglobulins and autoantibodies (14;16;17). B cell development is altered such that early B-cell progenitors are reduced in the bone marrow (BM), accompanied by polyclonal B cell activation. T cell development is also abnormal in me and me-v mice.
 
In double mutant Ptpn6me-v/me-vRag1-/- mice which lack B and T cells and cannot generate autoantibodies, severe inflammatory lesions in which macrophages and granulocytes infiltrate healthy tissues still develop, indicating that chronic inflammatory disease progression in Ptpn6me-v mutants does not require the adaptive immune response (18). On the other hand, mice lacking Ptpn6 expression only in B lymphocytes develop both autoimmunity and chronic inflammatory disease, as evidenced by increased levels of serum immunoglobulins reactive to single- and double-stranded DNA, lymphocytic infiltrates of the lung and liver, and glomerulonephritis (19). These data indicate that development of autoimmunity in Ptpn6 mutants requires the adaptive immune system, and that Ptpn6 deficiency need only affect B cells to cause autoimmunity marked by autoantibody production and autoreactive T cells. It is also clear that the innate immune response plays a separate and essential part in disease pathogenesis.
 
Cells use phosphorylation to regulate the activity of signaling pathways that direct diverse biological processes, and carry out this reaction via the coordinated action of kinases and phosphatases. In vitro studies using cells derived from me or me-v mice indicate that SHP1 serves to downregulate multiple hematopoietic signaling pathways, including those stimulated by IFN-α (20), colony-stimulating factor (CSF)-1 (also known as macrophage colony-stimulating factor) (21-23), interleukin (IL)-3 (24), erythropoietin (EPO) (25) and stem cell factor (SCF) (26). However, the physiological importance of SHP1 action in preventing inflammatory disease remains unclear where most of these pathways are concerned.
Putative Mechanism
Spin mice exhibit the least severe phenotype in the existing Ptpn6 allelic series, where Ptpn6me is a null allele and Ptpn6me-v encodes a phosphatase with approximately 20% of wild type catalytic activity (11;12). The relatively mild spin phenotype suggests that SHP1 encoded by Ptpn6spin retains the most functionality among the three alleles. Notably, Ptpn6spin/spin mice do not develop the immunodeficiency (at least in the context of MCMV and Listeria infections) or lethal pneumonitis seen in either of the motheaten mutants. Additionally, while Ptpn6me/me and Ptpn6me-v/me-v mice are infertile and die by 3 weeks and 9 weeks of age, respectively (14), Ptpn6spin/spin mice are fertile and survive for over one year. Because no abnormal phenotype is seen in a Ptpn6me/+ heterozygote, which has about 50% of normal SHP1 activity, and severe disease is seen in Ptpn6me-v/me-v mice, which have about 20% of normal SHP1 activity, it may also be deduced that SHP1 catalytic activity in Ptpn6spin/spin mice is between 20% and 50% of normal.
 
The development of disease in Ptpn6me-v/me-vmice has previously been suggested to stem from the increased production and/or signaling of proinflammatory cytokines. Elevated levels of TNF or TNF mRNA have been reported in the sera and cells of Ptpn6me-v/me-v relative to wild type mice (27-30). Anti-TNF antibody administration reduced lung tissue injury in Ptpn6me/me bone marrow chimeras (29), and treatment with soluble TNF receptor reduced dermatitis, pneumonitis and inflammatory lesions of the extremities in Ptpn6me/me mice (31). SHP1 has also been implicated in the downregulation of signaling elicited by type I IFN (e.g. JAK1 and STAT1 activation) (20). Strikingly, neither STAT1 nor TNF deficiency attenuates disease in spin homozygotes, indicating that whatever inhibitory effect SHP1 may normally have on TNF and IFN production or signaling, these cytokines do not drive the pathologic effects of SHP1 deficiency. It remains possible that the milder spin mutation does not affect TNF or IFN production or activities, while the more severe me and me-v mutations do.
 
Autoimmunity and inflammation in Ptpn6spin/spin mice requires both MyD88 signaling and commensal microbiota. The dual requirement for a genetic lesion and a suitable microbial driver in the pathogenesis of inflammation has previously been observed in other settings. For example, the severe inflammation observed in hemophagocytic lymphohistiocytosis (HLH) has been shown to result from mutations that prevent exocytosis of toxic granules from lymphoid cells [e.g. Unc13d (jinx), Rab27a], but only in the presence of an infectious driver such as lymphocytic choriomeningitis virus (LCMV) (32;33). The sustained inflammatory disease observed in HLH caused by lesions affecting the exocytic machinery is presumed to result from failure to eradicate the causal microbe, which accumulates in vivo and stimulates expansion of antigen-specific lymphoid clones. These in turn drive the expansion of myeloid cells that both present antigen and cause tissue injury. Although it remains possible that a failure of spin mutants to eliminate infections leads to chronic inflammation, the genetic data suggest that microbes initiate innate immune signaling via the TLR→MyD88/IRAK4 axis, which leads to IL-1 production. Signaling via the IL-1R→MyD88/IRAK4 axis causes chronic inflammation.  It is likely that autoimmunity results from utilization of the same pathways. 
 
Microbial sensing occurs in part through activation of TLRs, and MyD88 deficiency may block the sequence of events that leads to inflammation at this level in spin mice. However, other sensors including the NOD/NALP family of cytoplasmic receptors and/or the RIG-I-like helicases, also stimulate production of IL-1. Because IL-1 (but not TNF nor type I nor type II IFNs) appears to be essential for the development of inflammatory disease in spin homozygotes, MyD88 deficiency may suppress the spin phenotype by preventing IL-1 signaling. (The Myd88poc mutation ablates IL-1 (34) but not IL-18 signaling. IL-33 signaling has not been examined in Myd88poc homozygotes.) IL-1 is known to be an essential element in the pathogenesis of several severe inflammatory diseases, including neonatal onset multisystem inflammatory disease (NOMID), familial cold autoinflammatory syndrome (FCAS) (35), and certain cases of rheumatoid arthritis (36). Microbe-dependent production of IL-1 and subsequent IL-1 signaling also contribute to disease caused by hypomorphic mutations in SHP1.
 
IL-1 signaling, and signaling from many of the TLRs depends upon MyD88, IRAK4, to some extent IRAK1, TRAF6, the E2 ligase complex Ubc13/Uev1A (37), TAK1, TAB1, and components of the IKK complex, all of which represent candidate substrates for SHP1. Inflammation in spin mice is suppressed by MyD88 deficiency but not TICAM1 deficiency. An et al. (30) recently reported that SHP1 inhibits IRAK1 in a phosphatase-independent manner by directly binding to the kinase domain of IRAK1, to promote TLR-dependent type I IFN production. However, there was no requirement for IFN signaling in the inflammatory phenotype of spin mice, nor evidence that the phenotype is exaggerated in the absence of IFN signaling. The substrates of SHP1 and the cellular mediators contributing to disease in SHP1 mutants are important subjects of future study.
Genotyping
The spin mutation introduces a Hinc II restriction enzyme site in the Ptpn6 genomic DNA sequence.  Spin genotyping is performed by amplifying the region containing the mutation using PCR, followed by Hinc II restriction enzyme digestion.
 
Primers
Spin_F: 5’-acgctggagcttcagtggac-3’
Spin_R: 5’-tgaggtgagggaggacga-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 55°C             0:30
4) 72°C             0:45
5) repeat steps (2-4) 34X
6) 72°C             7:00
7) 4°C              ∞
 
The following sequence of 300 nucleotides (from Genbank genomic region NC_000072 for Ptpn6 linear genomic sequence) is amplified:
 
9959                                                                 ac
9961  gctggagctt cagtggactt aaggctgggg gtgccacgag gggggactca gccctgaagg
10021 gtggccttac ttggtgtccc ttcagggtgg acgctatact gtgggtggct cagagacgtt
10081 tgacagcctc acagacctgg tggagcactt caagaagaca gggattgagg aggcctcggg
10141 tgcctttgtc tacctgcggc aggtgagggg ccgacatgct tgcctcttcc cctgagccat
10201 cggagatgtg gctttctgag gtctctcggc cgctgacttc tcgtcctccc tcacctca
 
Primer binding sites are underlined; the novel Hinc II site is highlighted in gray; the mutated T is indicated in red.
 
Restriction Digest
Digest PCR reactions with Hinc II.  Run on 2% agarose gel with heterozygous and C57BL/6J controls.
Products: spin allele- 192 bp, 108 bp.  Wild type allele- 300 bp.
 References
   1.  Croker, B. A., Lawson, B. R., Berger, M., Eidenschenk, C., Blasius, A. L., Moresco, E. M. Y., Sovath, S., Cengia, L., Shultz, L. D., Theofilopoulos, A. N., Pettersson, S., and Beutler, B. (2008) Inflammation and autoimmunity caused by a SHP1 mutation depend on IL-1, MyD88, and a microbial trigger, Proc. Natl. Acad. Sci. ,USA , 105, 15028-15033.
 29.  Thrall, R. S., Vogel, S. N., Evans, R., and Shultz, L. D. (1997) Role of tumor necrosis factor-alpha in the spontaneous development of pulmonary fibrosis in viable motheaten mutant mice, Am. J. Pathol. 151, 1303-1310.
Science Writers Eva Marie Y. Moresco
AuthorsBen A. Croker, Bruce Beutler