Beutler Lab Website

Strains @ MMRRC

Display Strains By

Search Mutagenetix



Staff Login

save as PDF

Gene Symbol Tlr2
Gene Name toll-like receptor 2
Synonym(s) Ly105
Accession Number
Genbank: NM_011905; MGI: 1346060
Allele languid
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 3
Chromosomal Location 83.640-83.645 Mb (-)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
A to T at 83641237 bp
Amino Acid Change Asparagine changed to Isoleucine
Phenotypic Category immune system, TLR signaling defect- TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI

Tlr2tm1Aki, Tlr2tm1Dgen, Tlr2tm1Kir (Allele List at MGI)

Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Embryos, gDNA
Repository

MMRRC: 012838-UCD

Last Updated 02/03/2010 5:22 PM by Eva Marie Y. Moresco
Record Created unknown
Record Posted 10/30/2007
Phenotypic Description
The languid phenotype was identified in a G3 screen for mutants with altered response to Toll-like receptor (TLR) ligands (TLR Signaling Screen).  Peritoneal macrophages from homozygous languid mice fail to produce tumor necrosis factor (TNF)-α in response to the lipopeptides Pam3CSK4 (triacyl lipopeptide), Pam2CSK4 (diacyl lipopeptide), MALP-2 (macrophage-activating lipopeptide-2; diacyl lipopeptide) and peptidoglycan (all TLR2 ligands).  The deficit in TNF-α production by languid cells mirrors that of Tlr2-null cells. Languid cells produce normal levels of TNF-α in response to lipopolysaccharide (LPS; TLR4 ligand).  Heterozygous languid macrophages behave as wild type.

 

Nature of Mutation
The languid mutation was mapped to Chromosome 3, and corresponds to an A to T transversion at position 1971 of the Tlr2 transcript, in exon 3 of 3 total exons.
 
1955 CTCTATATTTCCAGAAATAAGCTGAAAACACTC
482  -L--Y--I--S--R--N--K--L--K--T--L-
 
The mutated nucleotide is indicated in red lettering, and results in an asparagine to isoleucine change at position 487 of the TLR2 protein.
Protein Prediction
TLR2 is a 784-amino acid type 1 transmembrane glycoprotein receptor, with regions of hydrophobicity corresponding to a signal peptide at its N-terminus and a transmembrane domain near the middle of the protein (1;2).  Like the other TLRs, its cytoplasmic domain shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (1;2), which mediates homo- and heterotypic protein interactions in signal transduction.  TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (3).  In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (2;4).  The crystal structures of the TLR1 and TLR2 TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (4) (Figure 1; PDB ID 1FYW).  Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions.  This is true of a proline to histidine mutation in the BB loop of TLR4, which abolishes MyD88 binding (5) and LPS-induced signaling in mice (6).
 
The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), each of which consists of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) and XØXXØX4FXXLX (variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (7)].  The XLXXLXLXX sequence folds into a β-strand.  TLR2 has 20 such LRRs (2;8).  Each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (7).  While “typical” LRR family proteins normally bind ligands on the concave surfaces of the horseshoe, the crystal structure of a TLR1-TLR2-Pam3CSK4 complex (ectodomains of the TLRs fused to the hagfish Variable Lymphocyte Receptor VLRB.61) revealed that ligand binding to TLR2 occurs in a crevice on the convex side of the horseshoe (8) (Figure 2; PDB ID 2Z7X).  The surface of this crevice is completely lined with hydrophobic resides from LRR modules 9-12 (8).  Crystallization of the complex also revealed that the Pam3CSK4 ligand is indispensable for heterodimerization of TLR1 and TLR2, because the ligand bridges the two proteins with its lipid chains (8).  In addition, Pam2CSK4, a diacylated peptide, could not induce heterodimerization of TLR1 and TLR2 (8).
 
The conserved asparagine residues at the end of XLXXLXLXXN consensus sequences of the LRRs create an “asparagine ladder” in which a continuous network of hydrogen bonds forms between the asparagines and neighboring backbone oxygens (8).  Since the β strands form the inner core of the ectodomain, disruption of the ladder is predicted to significantly affect the overall protein structure (9).  The languid mutation results in an asparagine to isoleucine change at position 487 of the TLR2 protein, in the conserved asparagine residue of LRR module 18.  An asparagine residue at this position is conserved in TLR2 orthologues from 14 mammalian species (10).  Mutant protein expression has not been examined in languid cells.
Expression/Localization
Northern blot analysis of human tissues revealed strong Tlr2 expression in peripheral blood leukocytes (1).  Tlr2 transcript is also detected in spleen, thymus, prostate, testis, ovary, small intestine, colon, lung, heart, brain and muscle (1;2).  TLR2 is localized on the cell surface, but may be recruited to macrophage phagosomes where it can be activated by phagocytosed ligands (11).
Background
TLRs are type I transmembrane proteins that sense molecules of microbial origin and trigger host cell responses.  There are 12 TLRs in mice, and 10 in humans, and each receptor recognizes a distinct microbial ligand. TLR2 recognizes microbial lipopeptides (12;13), lipoteichoic acid (LTA) (14) and zymosan (11).  TLR2 forms heterodimers with TLR1 or TLR6, to detect triacyl lipopeptides or diacyl lipopeptides, respectively.  The synthetic peptides Pam3CSK4 (tripalmitoyl-cysteinylseryl-(lysyl)3-lysine) and Pam2CSK4 (dipalmitoyl- cysteinylseryl-(lysyl)3-lysine) are commonly used as experimental ligands for TLR2.  Interestingly, some diacyl lipopeptides, such as Pam2CSK4, are recognized by TLR6-deficient cells (in a TLR2-dependent manner), suggesting that a TLR2 homodimer or a new heterodimer may recognize some lipopeptide species (15).
 
Upon ligand binding, the activated TLR2 heterodimer transduces the signal through the adapter proteins MyD88 and TIRAP (TIR-domain-containing adaptor protein), which recruit and activate several IRAKs (IL-1-receptor-associated kinases) and TRAF6 (tumor necrosis factor receptor-associated factor 6) [reviewed in (16;17)] (Figure 3)  Their functions lead to the activation of the IKK (IκB kinase) complex, which phosphorylates IκB, leading to the liberation of NF-κB for translocation to the nucleus and transcriptional activation. MAP kinase may also be activated through TRAF6; it controls AP-1 regulated gene expression.  Transcriptional activation of cytokines, including TNF and IL-6, results in the initiation of a local inflammatory response.
 
Study of the Cd36obl/obl (oblivious) mouse mutant demonstrated that the Cd36 receptor is required for TLR2-dependent detection of certain lipopeptides (18).  Oblivious macrophages exhibit reduced TNF-α production in response to MALP-2 and LTA, but normal TNF-α production stimulated by peptidoglycan, zymosan and Pam3CSK4 (18). Cd36obl/obl mice, like TLR2-deficient mice, are also highly susceptible to infection by Staphylococcus aureus (18;19).  Thus, while the nature of their interaction is unknown, Cd36 is a co-receptor for TLR2 recognition of certain ligands.
 
The Cd14 receptor also enhances signaling through TLR2 upon stimulation by lipopeptides (23-25).  Cd14 is a glycophosphatidylinositol-anchored LRR-containing protein found in proximity to TLR2 at the cell membrane, and proposed to facilitate the transfer of lipopeptide ligands to TLR2 complexes (23;24).  This nature of this transient interaction is also unknown.
 
In humans, a TLR2 polymorphism resulting in substitution of arginine for tryptophan at position 677 of TLR2 is associated with lepromatous leprosy (20), a disease caused by Mycobacterium leprae invasion of the peripheral nerves that primarily causes skin lesions (OMIM #246300).  TLR2 mediates innate immune recognition of M. leprae, and the Arg677Trp mutant fails to activate NF-κB in response to M. leprae when expressed in HEK293 cells (21).
Putative Mechanism
The languid mutation replaces the conserved asparagine residue of LRR module 18 of TLR2 with an isoleucine.  As mentioned above (Protein prediction), these conserved asparagines form an “asparagine ladder,” in which a continuous network of hydrogen bonds forms between the asparagines and neighboring backbone oxygens (8).  The β strands form the inner core of the ectodomain, and disruption of the ladder is predicted to significantly affect the overall protein structure (9).  Furthermore, LRR module 18 is near the end of the LRR series in TLR2, and would be positioned close to the C-terminal LRR (LRR-CT), whose sequence (and probably structure) is highly conserved both in Drosophila Toll and mammalian TLRs (7).  The LRR-CT of TLRs lies only two to ten residues from the transmembrane domain, and is believed to constrain the position of the LRR-CT at the membrane, and in turn the entire TLR ectodomain relative to the cell surface (7).  Mutations in the LRR-CT of Drosophila Toll can result in a constitutively active receptor (22).  The proximity of the languid mutation to the LRR-CT suggests that it may disrupt the position and structure of the LRR-CT, and thereby the entire ectodomain.  Consistent with this hypothesis, the languid phenotype closely resembles the phenotype of Tlr2-/- mice.
Genotyping
The languid mutation introduces an Mse I restriction enzyme site in the Tlr2 genomic DNA sequence.  Languid genotyping is performed by amplifying the region containing the mutation using PCR, followed by Mse I restriction enzyme digestion.
 
Primers
languid_F: 5’- CTCAGACGCTGGAGGTGTTGGATGTTAG -3’
languid_R: 5’- GCAGCCTGGTGACATTCCAAGACG -3’
 
PCR program
1) 94°C             5:00
2) 94°C             0:30
3) 55°C             0:30
4) 68°C             1:00
5) repeat steps (2-4) 39X
6) 68°C             10:00
7) 4°C                ∞
 
The following sequence of 400 nucleotides (from Genbank genomic region NC_000069 for Tlr2 linear genomic sequence) is amplified:
 
4360                                           c tcagacgctg gaggtgttgg
4381 atgttagtaa caacaatctt gactcatttt ctttgttctt gcctcggctg caagagctct
4441 atatttccag aaataagctg aaaacactcc cagatgcttc gttgttccct gtgttgctgg
4501 tcatgaaaat cagagagaat gcagtaagta ctttctctaa agaccaactt ggttcttttc
4561 ccaaactgga gactctggaa gcaggcgaca accactttgt ttgctcctgc gaactcctat
4621 cctttactat ggagacgcca gctctggctc aaatcctggt tgactggcca gacagctacc
4681 tgtgtgactc tccgcctcgc ctgcacggcc acaggcttca ggatgcccgg ccctccgtct
4741 tggaatgtca ccaggctgc
 
Primer binding sites are underlined; the novel Mse I site is highlighted in gray; the mutated A is indicated in red.
 
Restriction Digest
Digest PCR reactions with Mse I. Run on 2% agarose gel with heterozygous and C57BL/6J controls.
Products: languid allele- 94 bp, 306 bp.  Wild type allele- 400 bp.
 References
 22.  Schneider, D. S., Hudson, K. L., Lin, T. Y., and Anderson, K. V. (1991) Dominant and recessive mutations define functional domains of Toll, a transmembrane protein required for dorsal-ventral polarity in the Drosophila embryo., Genes Dev. 5, 797-807.
Science Writers Eva Marie Y. Moresco
AuthorsMichael Berger, Bruce Beutler