The lackadaisical phenotype was identified in a screen for ENU-induced mutants with altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1).  Peritoneal macrophages from lackadaisical mice produce reduced amounts of tumor necrosis factor (TNF)-α in response to resiquimod (TLR7 ligand) and unmethylated CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand).  The dose response curve ([TNF-α] versus [ligand]) for both ligands is shifted to the right, such that lackadaisical cells produce approximately the same amount of TNF-α as wild type cells when stimulated with a 10X higher ligand concentration (Figure 1). Lackadaisical macrophages display normal TNF-α responses to poly I:C (TLR3 ligand), lipopolysaccharide (LPS, TLR4 ligand), Pam₃CSK₄ (a triacyl lipopeptide, TLR2/1 ligand), and MALP-2 (a diacyl lipopeptide, TLR2/6 ligand).  Type I interferon production induced by either CpG ODN or resiquimod is abolished in lackadaisical macrophages (Figure 1).

 

Phosphorylation of JNK, the MAP kinase ERK, and IκB is eliminated in lackadaisical macrophages upon resiquimod stimulation.

 

When infected intraperitoneally with 5 x 10⁵ pfu of mouse cytomegalovirus, lackadaisical mice contain the virus as efficiently as wild type mice (MCMV Susceptibility and Resistance Screen), as measured by viral titers in the spleen and type I IFN concentration in serum.

 

The lackadaisical mutation was mapped to a region of Chromosome 9 including Myd88.  Sequencing identified an A to G transition in exon 2 (of 6 total exons) at position 428 of the Myd88 transcript.  The lackadaisical locus was confirmed to be allelic with Myd88.

The lackadaisical mutation results in the substitution of tyrosine with cysteine at residue 115 of MyD88, which exists in the intermediate domain between the death domain and the TIR domain.

 

The lackadaisical mutation changes a single residue in the intermediate domain of MyD88.  Alternative splicing of Myd88 results in a variant that lacks the intermediate domain (MyD88_s), which is expressed only in the spleen and brain (2). When overexpressed in HEK293 cells, MyD88_s is able to bind IRAK, but does not activate NF-κB (a hallmark of MyD88 signaling), reportedly because MyD88_s is unable to induce IRAK phosphorylation (2). The MyD88 intermediate domain has been suggested to provide for differential activation of distinct (NF-κB- versus JNK-dependent) transcriptional programs (3). MyD88_s has been postulated to act as a negative regulator of MyD88-dependent NF-κB activation (3).  MyD88_s expression is not detected in several cell lines of different origin, but may be induced after prolonged (16 hours) LPS treatment in a human monocytic cell line (2).  The protein encoded by Myd88^lck does not act as a dominant negative inhibitor of LPS-induced (or other ligand-induced) NF-κB activation, and therefore probably does not function like MyD88_s.  However, the lackadaisical phenotype supports the hypothesis that the intermediate domain is important for MyD88 function.  It appears that the lackadaisical mutation is a relatively mild loss-of-function mutation, since TLR signaling is retained at least partially (for TLRs 7 and 9), and in most cases completely (TLRs 3, 4, 2/1, 2/6), in these mutants.  In support of this conclusion, lackadaisical mice display robust resistance to MCMV infection.  On the other hand, complete loss of TLR9 function (e.g., in mice homozygous for the CpG1 allele) causes substantial impairment of MCMV resistance, despite retention of normal TLR7 signaling. The lackadaisical phenotype, as well as other studies, suggest that MyD88 is recruited to TLRs in a ligand-specific manner (1;4).  Distinct ligands likely bind distinct sites in TLR ectodomains (5), inducing unique receptor conformations intracellularly that may be recognized differentially by adapters.

Lackadaisical genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

1) lackadaisical(F): 5’- GCAGTCAGTGCTCTTACCGGCTGAG -3’

2) lackadaisical(R): 5’- AATGAGCAGCTTGCCCAAGGTCCC -3’

 

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:20

4) 68°C             1:00

5) repeat steps (2-4) 34X

6) 68°C             5:00

7) 4°C               ∞

 

2) lackadaisical_seq(F): 5’- TCTTACCGGCTGAGCCATCTC -3’

1) lackadaisical_seq(R): 5’- AAGGTCCCAGGTCCATCCATC -3’

 

The following sequence of 426 nucleotides (from Genbank genomic region NC_000075 for linear genomic DNA sequence of Myd88) is amplified:

 

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

  4.  Toshchakov, V. U., Basu, S., Fenton, M. J., and Vogel, S. N. (2005) Differential involvement of BB loops of toll-IL-1 resistance (TIR) domain-containing adapter proteins in TLR4- versus TLR2-mediated signal transduction, J. Immunol. 175, 494-500.

  5.  Meng, G., Grabiec, A., Vallon, M., Ebe, B., Hampel, S., Bessler, W., Wagner, H., and Kirschning, C. J. (2003) Cellular recognition of tri-/di-palmitoylated peptides is independent from a domain encompassing the N-terminal seven leucine-rich repeat (LRR)/LRR-like motifs of TLR2, J. Biol. Chem. 278, 39822-39829.