| Gene Symbol | Inpp5d | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Name | inositol polyphosphate-5-phosphatase D | ||||||||||||||||||||||||
| Synonym(s) | AI323613, MGC117680, SHIP, SHIP-1 , s-SHIP, SH2 containing inositol phosphotase, Src homology 2 domain-containing inositol-5-phosphatase, inositol polyphosphate-5-phosphatase, 145 kDa | ||||||||||||||||||||||||
| Accession Number | |||||||||||||||||||||||||
| Allele | styx | ||||||||||||||||||||||||
| Institutional Source | Beutler Lab | ||||||||||||||||||||||||
| Mapped | Yes | ||||||||||||||||||||||||
| Chromosome | 1 | ||||||||||||||||||||||||
| Chromosomal Location | 89.517-89.617 Mb (+) | ||||||||||||||||||||||||
| Type of Mutation | SPLICE DONOR SITE DESTROYED | ||||||||||||||||||||||||
| DNA Base Change (Sense Strand) |
T to A | ||||||||||||||||||||||||
| Amino Acid Change | |||||||||||||||||||||||||
| Phenotypic Category | decreased CD8 response, growth/size, hematopoietic system, homeostasis/metabolism, immune system, life span-post-weaning/aging, respiratory system | ||||||||||||||||||||||||
| Penetrance | Unknown | ||||||||||||||||||||||||
| Alleles Listed at MGI | |||||||||||||||||||||||||
| Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||
| Local Stock | Live Mice, Sperm | ||||||||||||||||||||||||
| Repository | MMRRC: 030820-UCD | ||||||||||||||||||||||||
| Last Updated | 12/14/2009 12:00 AM | ||||||||||||||||||||||||
| Record Created | unknown | ||||||||||||||||||||||||
| Record Posted | 11/20/2008 | ||||||||||||||||||||||||
| Phenotypic Description | The styx phenotype was discovered among ENU-mutagenized G3 mice in an in vivo natural killer (NK) cell and CD8+ cytotoxic T lymphocyte (CTL) cytotoxicity screen. G3 mice were immunized with irradiated 5E1 cells (syngeneic class I MHC-deficient cells transformed by human adenovirus type 5 early region 1). One week later, the same mice were injected with three target cell populations: control C57BL/6J cells, NK cell-specific target cells (syngeneic class I MHC-deficient cells), and an antigen-specific CTL target population (C57BL/6J splenocytes externally loaded with the adenovirus E1B protein). Styx mice exhibit a reduced ability to kill antigen-specific targets, demonstrating impaired CD8+ CTL function. Styx mice have progressive wasting disease, and exhibit a failure to thrive with some dying spontaneously. Thymic hypertrophy, and splenomegaly has been observed in these animals. Furthermore, infiltration of the lungs with neutrophils and eosinophils was also noted. Impairment of CTL function arises at later ages and appears to be a consequence rather than a cause of the wasting disease. Further phenotypic analysis is ongoing, but the phenotype of styx mice is similar to allelic Inpp5d (Ship-1) knockout mice (1;2).
|
||||||||||||||||||||||||
| Nature of Mutation | Due to the similarity of phenotypes between styx mutant mice and Inpp5d knockout animals, the Inpp5d gene was directly sequenced. The styx mutation corresponds to a T to A transversion in the donor splice site of intron 5 (GTAAC->GAAAC) of the Inpp5d gene (position 49406 in the Genbank genomic region NC_000067 for linear genomic DNA sequence of Inpp5d). The mutation is predicted to result in skipping of the 141-nucleotide exon 5 (out of 27 total exons) (3), and in-frame splicing to exon 6. This would result in deletion of 46 amino acids from the 1191 amino acid SHIP-1 protein. The effect of the mutation at the cDNA and protein level has not been tested.
<--exon 4 <--exon 5 intron 5--> exon 6--> <--exon 27
47675 GATACCAGTGG……GAGCTCCATGGGTAACGGAG…………GGAAGTCAT……………TGA 98945
177 -D--T--S--………-E--L--H--……… G--E--V--………………-* 1145
correct deleted correct
The donor splice site of intron 5, which is destroyed by the styx mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.
| ||||||||||||||||||||||||
| Protein Prediction | Inpp5d encodes SHIP-1, an 1191-amino acid Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase, which has 87% identity with its human homologue (4;5). The SHIP-1 (hereafter SHIP) protein contains an N-terminal SH2 domain (residues 8-100), two centrally located inositol polyphosphate 5-phosphatase motifs (residues 585-596 and 667-694), two NPXY motifs that, if phosphorylated, could be bound by phosphotyrosine-binding (PTB) domains (residues 913-917 and 1016-1020), and a C-terminal proline-rich domain with several SH3 binding motifs (4;6;7). The SHIP SH2 domain has been shown to bind to immunoreceptor tyrosine-based activation or inhibitory motifs (ITAMs or ITIMs) present in the cytoplasmic regions of many receptors (8), while the PTB-binding motifs and SH3-binding motifs have been shown to interact with the adaptor proteins Src homologous and collagen (Shc) and growth factor receptor-bound (Grb) 2, respectively (4;6;7). These adaptor proteins are known to link tyrosine-phosphorylated receptors to various downstream signaling pathways. In protein domain studies, the phosphatase domain and proline-rich C-terminal region were both necessary for SHIP phosphatase activity. Mutation of the PTB-binding motifs only partially affected SHIP activity (9). However, other studies have shown that these motifs, along with the SH2 domain of SHIP, are necessary for the interaction of SHIP with Shc (10;11). SHIP is closely related to the more ubiquitously expressed SHIP2, an inositol phosphatase with a similar overall structure (12). SHIP is known to have several isoforms created by alternative splicing, proteolytic cleavage or a combination of both [reviewed in (12;13)] (Figure 1). Some of these isoforms have C-terminal truncations or alternative C-terminal regions (3;14), others contain extended or truncated N-terminal domains (6), or internal deletions. Two of these isoforms (SHIPβ and SHIPδ) have C-terminal alterations that remove potential SH3-domain binding regions and disrupt a potential binding site for the p85 subunit of phosphatidylinositol 3-kinase (PI3K; this binding site overlaps the first PTB-binding motif and has the sequence NPNYIGM) (12;15). Interestingly, one of the SHIP isoforms (sSHIP) does not utilize the intron 5 donor splice site. Instead, this sequence uses an alternative promoter found in intron 5 to add an extra nine amino acids to the protein sequence coded by exons 6-27 (6;16). Thus, this isoform is missing the N-terminal SH2 domain and the amino acid sequence deleted by the styx mutation, but is able to interact with Grb2. If the altered SHIP protein produced from the styx allele is stable, it may also be partially functional. | ||||||||||||||||||||||||
| Expression/Localization | Although Inpp5d-derived transcripts have been found in many tissue types (4;5), SHIP is expressed primarily in hematopoietic cells, and the expression seen in most other tissues is likely due to contaminating hematopoietic cells (17). During mouse development, SHIP-encoding mRNA and SHIP protein are first expressed in late primitive-streak stage embryos when hematopoiesis is thought to begin, and expression is restricted to the hematopoietic lineage. In adult mice, SHIP expression continues in most cells of hematopoietic origin, including granulocytes, monocytes, and lymphocytes, and is also found in the spermatids of the testis. Furthermore, the level of SHIP expression is developmentally regulated during T-cell maturation, with mature T cells expressing higher levels of SHIP than immature T cells (17). In contrast, the highest levels of SHIP expression within the B cell compartment of the bone marrow are detected in the most immature B cell subsets (2), while loss of SHIP expression during erythropoiesis may be necessary for terminal erythroid differentiation (18).
The SHIP isoforms are expressed differentially according to the particular hematopoietic cell type and stage of development [reviewed by (18)]. For example, sSHIP is specific to embryonic stem cells, co-expressed with full-length SHIP in hematopoietic stem cells, and may be important for the maintenance of pluripotent stem cell populations (16;19). In general, bone marrow or immature hematopoietic cell lines express increasingly larger SHIP proteins as differentiation proceeds to mature blood cells (20).
| ||||||||||||||||||||||||
| Background | The SHIP protein was initially identified and cloned through its interaction with Shc, Grb2 and immunoreceptors (4;6-8). SHIP was also isolated by gene-trapping of genes that respond to the bacterial endotoxin lipopolysaccharide (LPS) in B-lymphoid cells (24). After exposure of hematopoietic cells to a wide array of extracellular stimuli including cytokines, growth factors, antibodies, chemokines and integrin ligands, SHIP is recruited to immunoreceptors, particularly those involved in inhibitory signaling of immune cell activation, where it becomes tyrosine phosphorylated and associates with adaptor proteins such as Shc [reviewed in (12;13;18)]. SHIP specifically recognizes and cleaves the 5’ phosphate group from phosphatidylinositol–3,4,5-trisphosphate (PIP3) to produce PtdIns(3,4)P2 (4;7). The 3′ position of the inositol phospholipid must be phosphorylated by phosphatidylinositol 3-kinase (PI3K) before SHIP can dephosphorylate the 5′ position (4), suggesting that SHIP acts sequentially with phosphatidylinositol 3 kinase (PI3K) in an inositol phospholipid pathway. Once it has been recruited to the plasma membrane of immune cells by tyrosine-phosphorylated ITIM-containing receptors (in some cases ITAM-containing receptors), SHIP is able to associate with phospholipids where it depletes the PIP3 pool and prevents membrane localization of some pleckstrin homology (PH) domain-containing effectors including the serine/threonine kinase Akt (also known as protein kinase B or PKB), ultimately leading to impaired PI3K-dependent signaling and attenuation of immune activation and growth factor survivor signals (Figure 2). Purified SHIP is also able to remove the 5’ phosphate group from Ins(1,3,4,5)P4 (IP4), and PtdIns(4,5)P2, but these interactions have not been demonstrated in immune cells (25). Inositol phopholipids fulfill roles as second messengers by interacting with lipid-binding proteins that are involved in a wide variety of biological processes [reviewed in (26;27)]. Some of these inositol phospholipids, along with their targets and biological effects are summarized in Table 1. Table 1. Targets and functions of inositol phospholipids*
* Not a comprehensive listing
The broad expression of SHIP in hematopoietic cells, along with the interconnected functions of these cells sometimes makes interpretation of SHIP function difficult. Genetic analysis of Inpp5d knockout mice suggests that SHIP plays a critical role in most of these cell types [reviewed in (13;18)]. Although viable and fertile, Inpp5d knockout mice fail to thrive, and survival is 40% by 14 weeks of age. The mice exhibit progressive splenomegaly as well as a myeloproliferative syndrome with consolidation of the lungs caused by infiltration of macrophages and neutrophils. Granulocytic and monocytic/macrophage progenitors from these animals show abnormally robust responses to suboptimal levels of cytokines, growth factors and chemokines (1), suggesting an inhibitory role for SHIP on hematopoietic progenitors and explaining the increase seen in granulocytes and macrophages in the knockout mice. The lack of negative regulation of macrophage cell growth and survival also explains the increase in osteoclasts and presence of osteoporosis in these animals as osteoclasts derive from progenitors of the monocyte/macrophage lineage (28). SHIP has been shown to play a role in regulating the receptor repertoire and cytolytic function of natural killer (NK) cells (22;29;30), B lymphocyte development and antibody production (2), the myeloid cell response to bacterial mitogens (31), loss of marginal zone B cells (MZB) (32), lymph node recruitment of dendritic cells (DC) as well as alterations in myeloid DCs (33;34), mast cell degranulation (35) and the homeostasis and function of myeloid immunoregulatory cells (33;36). Some of these functions are discussed in more detail below.
Lethally irradiated SHIP-deficient mice exhibit an interesting phenotype when transplanted with MHC-mismatched bone marrow (BM) grafts [reviewed in (13)]. Inpp5d−/− hosts fail to reject these grafts and are relatively resistant to graft-versus-host disease (GvHD), in which donor T cells in the transplanted marrow mount an immunologic attack against the host (29). In general, SHIP-deficient mice exhibit an increase in peripheral NK cells due to enhanced survival of these cells (26), a phenotype that is consistent with the increased numbers of myeloid cells found in these animals. The enhanced survival of NK cells in SHIP-deficient mice is correlated with an increased proportion of NK cells expressing certain NK cell receptors. A likely explanation of this disruption is that SHIP may be normally recruited to certain inhibitory receptors expressed by NK cells to oppose intracellular signals that mediate survival of the NK subsets expressing these receptors. The lack of SHIP results in enhanced survival of these NK cell subsets. Since acute rejection of bone marrow transplants by the host is partially mediated by host NK cells that persist following pre-transplant myeloablation, compromised acute rejection of BM grafts in SHIP-deficient mice is likely caused by the profound disruption of NK receptor (NKR) expression and changes in signaling by overrepresented inhibitory receptors. This results in a skewed balance in favor of inhibitory versus activating signals in SHIP-deficient NK cells that causes impairment of cytolysis of NK target cells expressing both self ligands for inhibitory receptors and ligands for activating receptors (30). Despite this defect, rejection of simple “missing self” targets by SHIP-deficient NK cells appears to be intact (29). Other studies have shown that SHIP is a negative regulator of NK cell antibody-dependent cellular cytotoxicity (ADCC) (22).
The lack of GvHD found in SHIP-deficient hosts may be partially explained by T cell abnormalities observed in these animals [reviewed by (13;37)]. Although donor T cells cause lethal GvHD, this process is initiated by surviving host antigen presenting cells (APC) present in secondary lymphoid tissue. Inpp5d-/- mice have normal numbers of peripheral APC (30), but exhibit excessive numbers of regulatory T (Treg) cells in peripheral lymphoid tissues (38). Moreover, naive CD4+CD25− T cells inappropriately acquire expression of forkhead box protein 3 (FoxP3) (see record for crusty), a transcription factor that is normally expressed specifically in Treg cells (13). Tregs negatively regulate T cell activity and can suppress allogeneic T cell responses. It is possible that some of these cells may persist in irradiated SHIP-deficient hosts and contribute to the suppression of GvHD in these animals. In addition to these in vivo T cell abnormalities, SHIP-deficient cytotoxic CD8+ T cells appear to have enhanced cytotoxic responses in vitro (39).
SHIP has a critical role in macrophages (and other myeloid cell types) as SHIP-deficient mice have increased numbers of these cells. Furthermore, the absence of SHIP increases macrophage phagocytosis, H202 generation and chemotaxis [reviewed in (18)], suggesting that SHIP is a negative regulator of macrophage function. Recently, it has been demonstrated that SHIP is necessary for the development of killer, classically activated, M1 macrophages that are important in killing bacteria, viruses and tumor cells (36). Macrophages in SHIP-deficient mice are skewed towards an M2 (healer) phenotype. M2 macrophages play important roles in phagocytosing cellular debris and stimulating host cell proliferation following the destruction of an infectious agent. Recently, SHIP-deficient mice have been shown to be susceptible to the bacterium Salmonella enterica serovar typhimurium (40). This phenotype is likely due to the observed skewing of the macrophage population in Inpp5d knockout animals to M2 rather than M1 macrophages.
Due to its broad effects in hematopoietic cells, it is likely that defects in SHIP function play a role in various human diseases. Indeed, alterations in SHIP levels and activity have been implicated in allergies, chronic periodontitis, osteoporosis, and various leukemias [reviewed in (18)]. Additionally, inactivating mutations of Inpp5d have been reported in the blast cells of patients with acute myelogenous leukemia (AML) and acute lymphoblastic leukemia (ALL) (41;42), suggesting that SHIP normally acts as a tumor suppressor in hematopoietic progenitors. | ||||||||||||||||||||||||
| Putative Mechanism | The phenotypes seen in Inpp5d knockout mice resemble those seen in mice deficient for the protein tyrosine phosphatase SHP1 (see the record for spin), mice doubly deficient for the Src tyrosine kinases, Lyn and Hck (43;44), as well as mice deficient for the phosphatase PTEN (phosphatase and tensin homologue deleted on chromosome 10) [reviewed by (18)]. Lyn/Hck establishes immunoreceptor tyrosine-based inhibitory motif-dependent (ITIM-dependent) signaling. ITIM-containing inhibitory receptors phosphorylated by Lyn recruit protein tyrosine phosphatases such as SHP1 to the plasma membrane. The similarity of phenotypes of mice deficient in Lyn/Hck, SHP1, and SHIP suggests that Lyn/Hck also signal through SHIP. Conversely, it has been shown that in the absence of SHIP, SHP1 is inappropriately recruited to the upregulated NK cell inhibitory receptors seen in SHIP-deficient mice (see Background). Inhibition of SHP1 activity restores the cytolytic activity of SHIP-deficient NK cells against certain targets (30). PTEN, like SHIP, is critical for regulating PIP3 levels and inhibiting the PI3K-dependent pathways, suggesting that it is the higher levels of PIP3 found in Inpp5d knockout mice that are primarily responsible for their phenotype.
The bulk of the evidence suggests that SHIP plays a negative role in most hematopoietic cells by being recruited to receptor associated signaling complexes where it can hydrolyze PIP3 and limit growth, survival and activating signals dependent on PIP3 signaling (Figure 2). In many cases, SHIP is recruited by inhibitory receptors and attenuates activating signals through other receptors. The lack of these negative signals results in an imbalance in signaling in many hematopoietic cell types leading to the phenotypes described. In keeping with its inhibitory roles on immune cell signaling, SHIP has been shown to negatively regulate NF-κB activation in various cell types, including toll-like receptor 2 (TLR2; see languid)-induced neutrophil activation (35;45). It has also been demonstrated that the transforming growth factor beta (TGF-β) and activin growth factors, which are potent inhibitors of hematopoietic cell proliferation and survival, dramatically upregulate SHIP mRNA and protein (46). However, SHIP has also been implicated in positive signals. For example, SHIP has been found to be important for normal platelet function (47), and plays a positive role in phagosome maturation by altering the composition of membrane phospholipids (48). In response to the TLR4 ligand LPS (see lps3), SHIP is upregulated in macrophages and in vitro positively activates NF-κB signaling (46). However, it has also been shown that the upregulation of SHIP in response to LPS (and CpG DNA; see CpG1) leads to a dampening down of the inflammatory response, including NF-κB targets, upon subsequent exposure to these factors (18;31;49). Whether SHIP has a positive or negative signaling role in a particular cell may be due to the nature of the specific stimulus, and suggests that SHIP is a critical balancing factor for determining positive or negative outputs in response to certain signals.
Due to the broad function of SHIP in most hematopoietic cells, it is not always clear whether the effects of SHIP deletion on immune cells are direct or indirect as cytokine levels in SHIP-deficient mice are altered and will affect some cell types. In vitro experiments with highly purified SHIP-deficient NK cells, myeloid suppressor cells and mast cells suggest SHIP plays a cell autonomous role in signaling pathways that control the function of these cells [reviewed in (18)], but uncertainty remains as to whether the in vivo phenotypes are actually intrinsic to the defective cell type or whether they are caused by the abnormal levels of cytokines observed in Inpp5d-/- animals. This issue has been partially addressed by the analysis of conditional knockouts. Mice in which SHIP expression was knocked down specifically in macrophages developed similar splenomegaly and alterations of MZB cells as SHIP-deficient mice. The mislocalization of marginal zone macrophages was found to be the cause underlying the loss of MZB cells in the spleen (32). It is likely that many of the phenotypes seen in the knockout animal are due to a primary defect in myeloid cells. Indeed, the most striking defect seen in Inpp5d-/- mice is the overproduction of myeloid cells, including macrophages (1). These cells produce high levels of the cytokine interleukin-6 (IL-6), which directly contributes to the reduced level of B cells seen in these mice as IL-6 is known to inhibit B cell development while enhancing myeloid cell development (50). Similarly, the expansion of myeloid cells may also contribute to the lack of GvHD observed in transplanted Inpp5d-/- animals. In addition to the expansion of other myeloid cell types, SHIP-deficient animals carry large numbers of myeloid suppressor cells that are potent antagonists of allogeneic T cell activation by host APCs in vitro (33). As discussed above (see Background), the increase in Treg cells has also been postulated to suppress T cell activation in SHIP-deficient mice. However, it has now been shown that this phenotype is caused by the SHIP-deficient environment as T-cell specific Inpp5d deletion does not affect T cell development, T cell activation or the number of Treg cells. Instead, SHIP-deficient T cells do not produce a type 2 T helper (Th2) response, which is important in determining B cell antibody class switching, when exposed to the proper stimuli (39). These studies illustrate the complexity of the SHIP-deficient phenotype, and suggest the need for further work to be done to address the roles of SHIP in specific immune cells.
The styx mutation may result in skipping of exon 5, which does not code for any known SHIP-1 domains. However, many of these amino acids are well-conserved across species (5), and the phenotype of styx mice greatly resembles the phenotype of Inpp5d knockout animals (1;2) suggesting that the styx mutation results in severely reduced SHIP function. It remains likely that the Inpp5d knockouts are not true nulls as they remove only the primary promoter and the first exon of the gene, but not the stem cell specific promoter leaving expression of the stem cell specific SHIP isoform (sSHIP) intact. A similar mechanism may occur in styx mice, as removal of exon 5 due to an impaired intron 5 donor site may not affect normal expression of s-SHIP. Thus, a true Inpp5d knockout may have a much more severe phenotype than the one exhibited by the current model. Additionally, SHIP function may be partially redundant with SHIP2, as they have similar activities and functions and have overlapping expression patterns (12). | ||||||||||||||||||||||||
| Genotyping | Styx genotyping is performed by amplifying the region containing the mutation using PCR, followed by BstE II restriction enzyme digestion. The reverse PCR primer introduces a BstE II site (5’-GGTNACC-3’) into the wild type PCR product, while the styx mutation would alter this introduced site. The single nucleotide change in the reverse primer that introduces the restriction site is shown in purple text.
Primers for PCR amplification
Styx(F): 5’- ATTCCGACTTTTTGAAGACGGGCTCCAG -3’
Styx(R): 5’- ACCCCTCTCTCAGGGCTCTCGGTT -3’
PCR program (use SIGMA JumpStart REDTaq)
1) 94°C 10:00
2) 94°C 0:30
3) 58°C 0:30
4) 72°C 0:30
5) repeat steps (2-4) 32X
6) 72°C 10:00
7) 4°C ∞
The following sequence of 108 nucleotides (from Genbank genomic region NC_000067 for linear DNA sequence of Inpp5d) is amplified:
49323 attccgac tttttgaaga cgggctccag caacctccct cacctgaaga agctgatgtc
49381 actgctctgc aaggagctcc atgggtaacg gagagccctg agagaggggt
The primer binding sites are underlined; the introduced BstE II site is highlighted in gray; the nucleotide that will be changed by PCR is shown in purple text. This site is destroyed by the styx mutation with the mutated T shown in red text.
Restriction Digest
10μl PCR reaction
17μl ddH2O
3μl NEB Buffer 3
0.5μl BstE II
Incubate 2 hours – overnight at 60°C
Run on 3% agarose gel with heterozygous and C57BL/6J controls.
Products: styx allele- 108 bp. Wild type allele- 82 bp, 26 bp.
| ||||||||||||||||||||||||
| References | |||||||||||||||||||||||||
| Science Writers | Nora G. Smart | ||||||||||||||||||||||||
| Authors | Philippe Krebs, Bruce Beutler |