Beutler Lab Website

Strains @ MMRRC

Display Strains By

Search Mutagenetix



Staff Login

save as PDF

Gene Symbol Trfr2
Gene Name transferrin receptor 2
Synonym(s) Tfr2
Accession Number

Genbank: NM_015799, MGI:1354956

Allele iron-man
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 5
Chromosomal Location 138.011-138.029 Mb (+)
Type of Mutation SPLICE DONOR SITE DESTROYED
DNA Base Change
(Sense Strand)
T to C
Amino Acid Change
Phenotypic Category homeostasis/metabolism
Penetrance 100 
Alleles Listed at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Gene trapped(1) Chemically induced(1)

Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
Repository

MMRRC: 031132

Last Updated 01/18/2010 12:00 AM
Record Created unknown
Record Posted 05/26/2009
Phenotypic Description

The recessive iron-man phenotype was discovered in ENU-mutagenized G3 mice while screening for altered levels of serum iron. Homozygous iron-man mice display elevated levels of serum iron and ferritin, the main intracellular iron storage protein (Figure 1A). Iron-man animals also display reduced levels of the hormone hepcidin, the major systemic iron regulator (1;2) (Figure 1B). These phenotypes suggest homozygous iron-man mice have the iron overload condition, hereditary hemochromatosis. Please see the records for mask, zorro, and masquerade for examples of mutants with iron deficiency.

Nature of Mutation
The iron-man mutation is a T to C transition in the donor splice site of intron15 (GTAAG -> GCAAG) of the Trfr2 gene on Chromosome 5 (position 13302 in the Genbank genomic region for linear genomic DNA sequence of Trfr2). Trfr2 contains 19 exons. 
 
The mutation destroys the donor splice site of intron 15. No normal transcripts are detected in homozygous iron-man mice; cDNA sequencing demonstrates two abnormal splice products that would encode proteins containing aberrant amino acids. The original acceptor splice site of intron 15 is no longer used, and both transcripts read through intron 15. The first transcript results from the usage of a cryptic acceptor splice site in intron 16, and includes the 80 nucleotides of intron 15, exon 16 (85 nucleotides), plus 19 extra nucleotides from the 3’ end of intron 16. This results in the addition of 61 aberrant amino acids after amino acid 531, followed by resumption of the normal reading frame in exon 17. In the following diagram, the donor splice site of intron 15 is shown in blue; the mutation is indicated in red lettering; the new acceptor splice site is highlighted in gray:
 
                <--exon 15 intron 15--> <--exon 16 intron 16--> <--intron 16 exon 17--> <--exon 19
13290 GATGCTGAAGT GCAAGTAGAA…………TTCATGGAG…GCCCAGCCCCTCCATGTCCCTGCAG GATGATCGG………AACTTTTGA 17254
528   -D--A--E--V- -Q--V--E-……………-S--W--S-        -P--S--M--S--L--Q- -D--D--R-……-N--F--*  806
        correct    aberrant                                          correct
 
The other splice product results from use of the normal intron 16 acceptor splice site. This transcript still reads through intron 15, but does not contain extra nucleotides from intron 16. The mutation destroys the reading frame after amino acid 531, resulting in the addition of 97 aberrant amino acids followed by premature truncation at amino acid 628. In the following diagram, donor splice site of intron 15 is shown in blue; the mutation is indicated in red lettering; the intron 16 acceptor splice site is highlighted in gray:
 
       <--exon 15 intron 15--> <--exon 16 <--intron 16 exon 17--> <--exon 17
13290 GATGCTGAAGT GCAAGTAGAA…………TTCATGGAG…………TCCCTGCAG GATGATCGGG……TCCGACTGA 13687
528   -D--A--E--V- -Q--V--E-……………-S--W--R-              -M--I--G-……-S--D--*  628
        correct    aberrant
 
Protein Prediction
The Trfr2 cDNA encodes a 798-amino acid protein that demonstrates an overall 39% identity (and 53% similarity) to the classical transferrin receptor (TfR1). The human orthologue is three amino acids longer than mouse TfR2, but the amino acid sequences are highly conserved (84%). Like TfR1, TfR2 is a transmembrane type II protein containing a short intracellular domain (amino acids 1-78), followed by a single transmembrane domain (amino acids 79-102), and an extensive extracellular domain (amino acids 103-798) (3;4)
 
The extracellular domain of TfR2 is 66% similar to that of TfR1, and like TfR1 contains an RGD sequence (amino acids 673-675) that is required for binding to the iron carrier, transferrin (5;6). TfR2 binds iron-bound transferrin (holotransferrin) at a 25-fold lower affinity than does TfR1 (7;8). The extracellular domain of TfR2 also includes a protease-associated (PA) domain (amino acids 231-330), which have also been identified in several peptidases as well as a plant vacuolar sorting receptor (9). Human TfR2 is N-glycosylated in vitro (7), and potential N-glycosylation sites exist at amino acids 235, 334, and 535 in mouse TfR2. Potential disulfide bonds exist at cysteines 106 and 109 homologous to the cysteines present in TfR1 that mediate homodimerization (10).
 
The extracellular domains of theTfR1 homodimer have been studied extensively, either alone (10), bound to holotransferrin (11), or in complex with the hemachromatosis protein HFE (12) (see Background). The TfR1 extracellular domain is subdivided into three different structural domains; the membrane-proximal PA domain, an apical domain, and a helical domain. The structure of the PA domain is similar to carboxy- or aminopeptidase with a central, seven-stranded β sheet and flanking α helices. The apical domain resembles a β sandwich with an α helix running along one edge. TfR1 homodimerizes through its helical domain, which consists of a four-helix bundle (10) (Figure 2). The first and third helices are formed by two sub-helices, and interact with HFE (12) (Figure 3). About half of the TfR residues that form contacts with HFE are replaced by different amino acids in TfR2, suggesting significant structural differences between TfR1 and TfR2 (8). The extracellular domain of TfR2 is able to bind to HFE, but unlike TfR1, does not require the RGD motif for this interaction (13). Crystallography of holotransferrin binding to TfR1 demonstrates that the N-terminal domain of holotransferrin is sandwiched between the membrane and the TfR1 ectodomain, while its C-terminal domain contacts the TfR1 helical domain, especially the RGD motif (11) (Figure 4). 
 
The putative intracellular domain of TfR2 is poorly conserved compared with the classical TfR, but does contain the sequence YRRV (YQRV in the human) that is similar to the internalization signal (YTRF) of TfR1. In TfR1, this sequence functions as a signal for endocytosis (14), and plays an important role in cellular iron uptake (see Background). Mutation of this motif in TfR2 disrupted the intracellular localization of the protein (15). A mitochondrial targeting signal, not present in TfR1, is found in the N-terminus of TfR2 (amino acids 1-28) (16).    
 
An alternatively spliced form of Trfr2/TFR2 exists in both mouse and humans, resulting in a protein isoform lacking the intracellular and transmembrane domains (3;4). This protein isoform is known as TfR2-β. 
 
The iron-man mutation destroys the donor splice site of intron 15. As described above (Nature of Mutation), two aberrant transcripts are produced in iron-man mice. The first transcript results in the addition of 61 aberrant amino acids in place of exon 16 (normal amino acids 557-584). Presumably, the structure of the aberrant protein is significantly perturbed, although the conserved RGD sequence necessary for transferrin binding is retained. The second transcript results in aberrant amino acids and premature truncation after amino acid 531, which would affect the RGD motif.  It is unknown if either of these transcripts produce stable protein.
Expression/Localization
In mouse and human,Trfr2/TFR2 mRNA is predominantly expressed in the liver. Low mRNA levels are also seen in other tissues (3;4). In humans, TFR2-β is expressed at very low levels in all tissues (3). During mouse embryonic development, Trfr2 mRNA is first expressed between embryonic (E) days 8 and 11. In the liver, expression increases during development from E13 to adulthood, while levels remain constant throughout development in the spleen (17)Trfr2 is downregulated during erythrocyte differentiation in vitro (18). Unlike Tfr1, Trfr2 gene expression is independent of cellular iron status (4;18)
 
Like the mRNA, TfR2 protein is predominantly expressed in hepatocytes of the liver (19;20). TfR2 is also expressed in duodenal crypt cells, the neural retina, and platelets (19;21-23). Although one study found TfR2 protein in erythroid precursor cells in the bone marrow (18), other data suggest that TfR2 is not expressed in normal erythroid precursors (24). Instead, expression is very high in erythroleukemic cell lines (18;19;24). Indeed, TfR2 is expressed in many different human cancer cell lines (25).
 
In cells, TfR2 was found to localize primarily to the plasma membranes in lipid rafts that are important for cell signaling complexes (26). In hepatocytes and retinal pigment epithelium (RPE) cells, TfR2 is localized to the basolateral surface of the plasma membrane (20;22;27). TfR2 also localizes to endosomes and other components of the intracellular trafficking and degradation pathways (15;21). In rat dopaminergic neurons, TfR2 was found to localize to the mitochondria (16). Subcellular localization of TfR2 is dependent on holotransferrin levels (15;16;19) (see Background).
Background
Iron is essential for a variety of metabolic processes because it binds oxygen and can readily accept and donate electrons. In excess, it can also produce oxidative stress. Thus, levels of iron in the body need to be tightly regulated and maintained. Because iron cannot be excreted, iron homeostasis is maintained by regulating the level of enteric iron absorption. The movement of iron from intestinal enterocytes into the bloodstream is mediated by the iron export channel ferroportin (28;29) with the aid of hephaestin, which oxidizes ferrous iron (Fe++) to the ferric state (Fe+++) (30). Once in the plasma, transferrin binds to ferric iron and mediates its transfer into cells via transferrin receptors. Iron uptake in erythroid precursors and incorporation into heme is essential for erythropoiesis (31). The liver plays a central role in regulating intestinal iron absorption, and serves as one of the main depots for iron storage in the body (Figure 5).
 
The transferrin receptor cycle is one of the best studied processes in mammalian cell biology. TfR1 is expressed ubiquitously at the cell surface and is responsible for binding transferrin and internalization of the molecule. Once this complex is endocytosed into the cell, the lower pH of the endosomes facilitates the release of iron from transferrin. Apotransferrin (transferrin without iron) still bound to the transferrin receptor is recycled back to the cell surface, and released into the serum where the cycle can begin again (9)TfR1 mRNA contains iron-responsive elements and is negatively regulated by intracellular iron stores, thus tightly controlling the amount of TfR1 available for iron uptake (32). Like TfR1, TfR2 binds to holotransferrin at neutral pH and apotransferrin at acidic pH (4), suggesting that it may also participate in cellular iron uptake (3;4). Unlike TfR1, TfR2 is expressed in specific tissues (see Expression/Localization) and TfR2 mRNA does not contain iron-regulatory elements (4;7), suggesting that TfR2 has a different function than TfR1 in regulating iron homeostasis (see Putative Mechanism).
 
Iron levels are systemically regulated by the peptide hormone hepcidin (also known as the hepatocyte antimicrobial peptide HAMP) (1;2). Hepcidin is expressed in and secreted into circulation from the liver (Figure 5). Hepcidin binds to ferroportin and causes internalization and proteolysis of the channel, preventing release of iron from intestinal cells into the plasma (33). In this manner, hepcidin lowers plasma iron levels, and chronic elevation of hepcidin levels causes systemic iron deficiency (34).  Conversely, hepcidin deficiency causes iron overload (35). Hepcidin expression is regulated by plasma iron levels, erythropoietic activity, hypoxia and inflammation (36), and involves the action of several proteins including HFE (37), TfR2 (38;39), and hemojuvelin (HJV) (40), which promote expression of the hepcidin gene, Hamp. Hemojuvelin contains a glycophosphatidylinositol anchor, and exists in both membrane-associated and soluble forms.  The membrane-bound form of HJV binds to a cell surface receptor to stimulate Hamp expression, while soluble HJV competitively inhibits this interaction (41;42). HFE and TfR2 are reported to associate with hemojuvelin in a stable cell surface complex that serves as a receptor for bone morphogenetic proteins (BMPs), which have been shown to upregulate Hamp (43-46).  In vitro, the interaction of HFE and TfR2 is necessary to upregulate Hamp expression in response to transferrin (47), and HFE and TfR2 co-localize in several tissues (21-23)Hamp expression is also positively regulated by the transcription factor SMAD4, through epigenetic modification of histone H3 to a transcriptionally active form (48). Recently, the transmembrane serine protease TMPRSS6 was found to be a non-redundant component in a pathway that senses iron deficiency and negatively regulates Hamp expression to promote iron uptake (49;50) (see the records for mask, zorro, and masquerade).
 
Humans and mice with mutations in TFR2 exhibit hemochromatosis (HFE3; OMIM #604250), a disease that is characterized by increased iron absorption and increased serum iron levels despite high body iron stores, and inappropriately low levels of hepcidin (20;38;39;51-53). Clinical presentations of hemochromatosis include liver cirrhosis, arthritis, diabetes, and cardiomyopathy. Although it has been suggested that TfR2 is highly expressed in erythrocyte precursors (18;19), humans and mice with TfR2 deficiency do not have erythropoietic defects (51;54).  Indeed, a liver-specific Trfr2 mouse knockout exhibits the same phenotypes as mice completely deficient for TfR2, suggesting the liver as the primary site of function for this protein (52).   
 
Hemochromatosis is also caused by defects in HFE (HFE1; OMIM +235200), hemojuvelin (HFE2A; OMIM #602390), hepcidin (HFE2B *606464) and ferroportin (HFE4; OMIM #606069). Defects in either HJV or hepcidin lead to a much more severe iron loading phenotype than patients with HFE or TfR2 defects. Patients that have mutations in both HFE and TFR2 are phenotypically similar to patients with mutations in HJV or Hamp alone (53). Juvenile hemochromatosis patients have undetectable levels of hepcidin, suggesting that HJV is essential for hepcidin expression (40). Unlike mutations in the other genes, mutations in the ferroportin gene cause an autosomal dominant disease, usually presenting with less severe phenotypes (53). Mutations in several other proteins mediating iron metabolism cause defects in iron homeostasis in both humans and mice. These include ceruloplasmin, divalent metal transporter 1 [DMT/ Nramp2 (natural resistance-associated macrophage protein 2)], ferritin, hephaestin, TMPRSS6, transferrin, and TfR1 (49;50;55).
 
In addition to hemochromatosis, TfR2 dysfunction may be linked to the development of Parkinson’s disease (PD; OMIM #168600). Abnormal iron accumulation occurs in the mitochondria of substantia nigra (SN) dopaminergic neurons of PD patients. A similar process was found to occur in a rat PD model, where iron deposits were correlated with excessive holotransferrin accumulation. TfR2, but not TfR1, was found to localize to the mitochondria of dopaminergic neurons, where it mediates uptake of holotransferrin (16).
Putative Mechanism
The localization of TfR2 in specific tissues, such as the liver and intestine, as well as the phenotypes caused by lack of TfR2 in mice and humans, suggest that TfR2 plays an important role in iron homeostasis.  Although TfR2 binds holotransferrin with low affinity, it is expressed at high levels in the liver and may still function as a high capacity transferrin receptor to mediate iron uptake into this tissue (8;17;18). Because TfR2 expression is independent of intracellular iron levels, it is possible that continued cellular uptake of iron through TfR2 causes the progressive iron overload phenotype observed in patients with hemochromatosis once TfR1 expression has been downregulated (4;56). However, patients with TFR2 mutations that cause partial loss of transferrin binding capacity still exhibit progressive iron overload (6;57), suggesting that TfR2 does not function primarily as a receptor to accumulate iron from transferrin. In vitro, TfR2 is able to mediate the uptake of both transferrin-bound and non-transferrin-bound iron (58).
 
Although TfR2 levels are generally not regulated by iron levels, they appear to be regulated post-translationally by holotransferrin levels, which increases the stability and half-life of TfR2 both in vitro and in vivo (59;60). These results suggest that TfR2 is capable of responding to variations in transferrin saturation by iron. An increase in iron-saturated transferrin levels would enhance the stability of the receptor, leading to increased binding of holotransferrin, and subsequent signaling events culminating in increased hepcidin expression. Increased levels of hepcidin would decrease the release of iron by ferroportin into the plasma thereby decreasing the levels of holotransferrin and eventually reducing Hamp expression. The interaction of HFE with both TfR1 and TfR2 is also essential for proper iron sensing (2;47).
 
The signal transduction pathway regulated by this iron sensing mechanism is still unclear, but the binding of transferrin to TfR2 localized to lipid rafts at the cell surface activates extracellular signal-regulated kinase (ERK)1/2 and p38 mitogen-activated protein kinase (MAPK) pathways (26).  Upregulation of hepcidin levels by inflammatory signals, namely interleukin (IL)-6 and lipopolysaccharide (LPS), appears to be independent of TfR2 (39)
 
The iron-man mutation affects the normal splicing of the Trfr2 gene, resulting in the production of aberrant transcripts. Both transcripts would produce proteins with significantly altered extracellular domains. It is possible that the first transcript may produce a protein with partial function as it retains most of the reading frame including the RGD motif. However, the iron-man phenotype suggests that this mutation is equivalent to complete loss-of-function of Trfr2 (20;51). Several TFR2 mutations found in human patients, including missense and splice site mutations, were analyzed and found to cause retention of the mutated protein in the endoplasmic reticulum (61). It is possible that the splice site mutation found in iron-man mice causes a similar phenotype and complete or nearly complete lack of protein function.   
Genotyping
Iron-man genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. 
 
Primers for PCR amplification
Iron(F): 5’- GCGTGCTACACCTCAAAGCTGTTG -3’
Iron(R): 5’- TGCCTGAGAACCACGTCTCCATAG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             10:00
7) 4°C               8
 
Primers for sequencing
Iron_seq(F): 5’- AGGAATCTATCCCTGAGCCCTG -3’
Iron_seq(R): 5’- CCGAAGTCTAGCGGCAGTAG -3’
 
The following sequence of 828 nucleotides (from Genbank genomic region NC_000071 for linear DNA sequence of Trfr2) is amplified:
 
12918                  gcg tgctacacct caaagctgtt gtgtacgtga gcctggacaa
12961 ctccgtgttg ggtgagctag ggtaaagcta ccgcctggcc ctctcaggtc tgtttatgca
13021 aaggaatcta tccctgagcc ctgcattcct cccctccctt ctcttcagga gatggcaaat
13081 tccatgctaa gaccagcccc cttctcgtca gcctcattga gaatatcttg aagcaggcaa
13141 gaggggactg cggctgggga tgagagaatc tcatgggagg gcagctcgaa gggggcagag
13201 gctgacctgt gcctctcatc taggtggact cccctaacca tagtggacag accctctatg
13261 aacaagtggc actcacccac cccagctggg atgctgaagt gtaagtagaa atgacagact
13321 gcggggtgga gactcgggag aaactgagtc cccagaggcc ttcaatctgc ctgccctcag
13381 gattcagccc ctgcccatgg acagcagtgc atattccttc acagcctttg cgggggtccc
13441 agctgtggag ttctccttca tggaggtgag actccccggc ccttgcccca ggacaccagg
13501 ccctcagcct gtcagcacca cgttcctgcg cccagcccct ccatgtccct gcaggatgat
13561 cgggtgtacc cattcctgca cacgaaggag gacacatatg agaatctgca caagatgctg
13621 cgaggtcgcc tgcccgccgt ggtccaggca gtggctcagc tcgcgggcca gctcctcatc
13681 cgactgagcc acgatcacct actgccgcta gacttcggcc gctatggaga cgtggttctc
13741 aggca
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
 References
   2. Oates, P. S., and Ahmed, U. (2007) Molecular Regulation of Hepatic Expression of Iron Regulatory Hormone Hepcidin. J. Gastroenterol. Hepatol. 22, 1378-1387.  61. Wallace, D. F., Summerville, L., Crampton, E. M., and Subramaniam, V. N. (2008) Defective Trafficking and Localization of Mutated Transferrin Receptor 2: Implications for Type 3 Hereditary Hemochromatosis. Am. J. Physiol. Cell. Physiol. 294, C383-90.
Science Writers Nora G. Smart
AuthorsXin Du, Bruce Beutler