Home Phenotypic Mutations Incidental Mutations Protocols FAQ Mutation Stats About Contact Links Request Mice

Click here to save record as a PDF

Gene Symbol

Ap3b1

  
Gene Name

adaptor-related protein complex 3, beta 1 subunit
Synonym(s)

AP-3; beta3A; Hps2; recombination induced mutation 2 (rim2); adaptin, beta-3A (adtb3A); pearl (pe); C78395; AU015684
Accession Number

Genbank: NM_009680; MGI: 1333879
Allele

bullet gray
Mapped

Yes 
Chromosome

13  

Chromosomal Location

95.129-95.336 Mb (+) 
Type of Mutation

SPLICE DONOR SITE DESTROYED
DNA Base Change (Sense Strand)

G to T 
Amino Acid Change

Phenotypic Category

immune system , MCMV susceptibility, pigmentation, skin/coat/nails
Penetrance

100% 
Alleles Listed at MGI

All alleles(44) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(27) Spontaneous(14) Chemically induced(1) 
Mode of Inheritance

Autosomal Recessive 
Local Stock

Embryos 
Repository

MMRRC: 030291-UCD 
Last Updated

10/16/2009 
Record Created

unknown  
Record Posted

09/28/2007 
Phenotypic Description   

The bullet gray phenotype was detected among ENU-induced homozygous mutant G3 mice. Bullet gray mice display light-colored fur, with a mixture of white and gray-brown hairs. The ears, feet and tail have a light pink color, while the eyes are black. As with the souris, sooty, salt and pepper and toffee phenotypes, bullet gray confers enhanced susceptibility to mouse cytomegalovirus (MCMV) infection (MCMV Susceptibility and Resistance Screen). Bullet gray is allelic to pearl (1;2).
Nature of Mutation
The bullet gray mutation is a G to T transversion in the donor splice site of intron 13 (GTGAGT -> TTGAGT) in the Ap3b1 gene on chromosome 13 (position 92056 in Genbank genomic region NC_000079 for linear genomic DNA sequence of Ap3b1). The mutation is predicted to result in skipping of the 133-nucleotide exon 13 (out of 27 total exons), destroying the reading frame in the middle of the encoded β3A polypeptide chain (aberrant amino acids after position 411), and creating a premature stop codon that would truncate the protein after amino acid 412.  The effect of the mutation at the cDNA and protein level has not been tested.
 
     <--exon 12  <--exon 13 intron 13--> exon 14-->
89477 GAATTTCAG……AACAGGGATGGTGAGTTCA……………AAATAGTTGTTG 96377
405   -E--F--Q-……-N--R--D-               -Q--*        412
        correct    deleted               aberrant
 
The donor splice site of intron 13, which is destroyed by the bullet gray mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.
 
Protein Prediction
AP-3 is one of four different heterotetrameric adaptor protein complexes (AP-1 to AP-4) in mammalian cells that decorate the cytoplasmic surface of membrane-bound vesicles at all levels from the trans-Golgi complex to the plasma membrane and direct subcelluar trafficking of membrane cargo proteins (3).  The subunits of AP complexes are called “adaptins” or “adaptin binding proteins,” and two large, one medium, and one small adaptin subunit are present in each AP complex.  The AP-3 complex is composed of β3, δ, μ3 and σ3 subunits, with each subunit existing in A (ubiquitous) and B (neuronal) isoforms encoded by distinct genes.  The 1105 amino acid β3A protein is one of the large subunits of the AP-3 complex and shares homology with the β1 and β2 subunits of the AP-1 and AP-2 complexes, respectively (4), and β-nonclathrin-associated phosphoprotein (NAP). 
 
The AP-1 and AP-2 complexes have an overall shape evocative of a “head” with two protruding “ears” separated by a hinge region, and it is believed that AP-3 has the same general shape (Figure 1) (5-7).  The A (“amino terminal”) region, or head domain, contains 12-13 Armadillo repeats, known to function in other settings as protein-protein interaction domains (8).  The H (“hinge”) region is strongly hydrophilic and rich in serine and acidic residues, and the C (“carboxy terminal”) region corresponds to an “ear” of the holoprotein complex.  The native human ortholog (obtained from M1 cells) has been detected in a phosphorylated state, likely reflecting phosphorylation of serine residues found in the H region (4).
 
Expression/Localization
Ap3b1 transcript was detected by Northern blot analysis in all human tissues examined, including heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas (4), and is also ubiquitously expressed in the mouse. The distribution of AP-3 complex was examined in NRK and MDBK cells (rat and bovine kidney cell lines, respectively), and found to co-localize with the trans-Golgi network (TGN) (9). AP-3 also decorates budding profiles on tubular endosomal compartments, likely on the way to lysosomes (10). The association of AP-3 with membranes is reportedly promoted by the small GTP-binding protein ARF-1 (ADP ribosylation factor-1) (11), although there has been no genetic confirmation of this interaction.
 
AP-1 and AP-2 bind clathrin directly, linking clathrin lattices to membranes within cells (3).  The human AP-3 complex has been reported to associate with clathrin in vitro and in HeLa cells (10;12;13).  However, another report indicated that it was not associated with clathrin, and controversy remains as to whether AP-3 function is clathrin-dependent (9;14).  Studies in yeast support a clathrin-independent function for AP-3 [reviewed in (15)].
 
Background
Hermansky-Pudlak syndromes (HPS; OMIM #203300) are a group of heterogeneous, autosomal recessive disorders caused by alterations at numerous independent loci (16).  Oculocutaneous albinism (OCA) and prolonged bleeding due to impaired platelet aggregation are common to all forms of HPS, but additional manifestations characterize specific types of HPS, such as pulmonary fibrosis (HPS-1 and HPS-4), and neutropenia and mild immunodeficiency (HPS-2). At the cellular level, HPS is caused by defects in the biogenesis of lysosome-related organelles, such as melanosomes, platelet dense granules, lamellar bodies of type II alveolar epithelial cells, and lytic granules of cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells. In particular, the pigmentation and bleeding problems associated with all forms of HPS arise from defects in melanosomes and platelet dense granules.
 
Each type of HPS is defined by the identity of the causative mutated gene. Eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease. The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (17); HPS2/pearl (18); HPS3/cocoa (mutated in pam gray) (19); HPS4/light ear (20); HPS5/ruby-eye 2 (mutated in toffee and dorian gray) (21); HPS6/ruby-eye (mutated in stamper-coat) (21); HPS7/sandy (mutated in salt and pepper) (22); and HPS8/putatively reduced pigmentation (23).  Most HPS genes encode subunits of protein complexes involved in intracellular trafficking (24). Based on biochemical studies, it has been proposed that the HPS proteins assemble into four stable complexes (Figure 2): biogenesis of lysosome-related organelle complex (BLOC)-1, BLOC-2, BLOC-3, and the adaptor protein-3 (AP-3) complex.  The 200-230 kD BLOC-1 complex consists of pallidin, dysbindin, BLOC subunit 1 (BLOS1), BLOS2, BLOS3, cappuccino, muted (mutated in minnie), and snapin.  BLOC-2 (350 kD) is composed of HPS3, HPS5, and HPS6.  The proteins HPS1 and HPS4 comprise BLOC-3 (175 kD).  BLOC-1 has been shown to interact with both BLOC-2 and AP-3 (25). Thus far, no interaction partner for BLOC-3 has been described (26).
 
Mutations in the β3A subunit of the AP-3 complex cause HPS-2 (OMIM #608233) (18;27-30). The AP complexes transport cargo proteins between components of the endocytic pathway, and AP-3 specifically shuttles proteins from the TGN to lysosomes and lysosome-related organelles (15;31).  Mutations of β3A are sufficient to dissociate the AP-3 complex and induce degradation of the other subunits (18;30).  Cargo recognition by AP-3 occurs through both tyrosine-based and dileucine-based lysosomal targeting motifs.  Thus, lysosome-associated membrane protein-1 (LAMP-1), LAMP-2, and CD63, cargo proteins for AP-3 which are sorted via tyrosine-based signals, fail to be recruited to lysosomes and accumulate at the plasma membrane in human fibroblasts with greatly reduced levels of AP-3 due to a mutation in β3A (10;18;30;32). Biochemical experiments demonstrate that AP-3 associates with dileucine-based signals of tyrosinase and lysosomal integral membrane protein-II (LIMP-II), but not other proteins containing dileucine motifs (32;33).  Tyrosinase and LIMP-II also accumulate at the cell membrane in AP-3 deficient cells (32).  
 
In addition to albinism and platelet aggregation deficiency, humans with HPS-2 exhibit neutropenia and immunodeficiency due to defects in NK cells and CTLs (27-29;34). In mice, mutations in the β3A subunit result in the pearl phenotype, which is characterized by hypopigmentation, lysosomal secretion abnormalities, and platelet-dense granules containing reduced levels of adenine nucleotides and serotonin (1).  Mutations in the mouse δ subunit of the AP-3 complex cause the similar mocha phenotype, with coat and eye color dilution, lysosomal abnormalities, platelet defects, and neurological defects (balance problems, deafness) (35). 
 
Interestingly, a particular mutation of AP3B1 in dogs, an insertion of an A residue within a tract of nine A residues in exon 20, results in canine cyclic neutropenia, also known as gray Collie syndrome because the dogs have a diluted coat color (36). The mutation leads to a frameshift and premature termination, and absent mRNA due to nonsense-mediated decay (37). Humans with cyclic neutropenia display three week oscillations in the circulating neutrophil count, with fluctuations between near zero and near normal levels (38). Monocytes also cycle in the opposite phase to neutrophils. In dogs, neutrophil counts cycle every two weeks, and all other blood cells cycle in opposite phase. No pigementation defects are observed in humans with cyclic neutropenia. Mutations in ELA2, encoding neutrophil elastase (NE), cause all known cases of human cyclic neutropenia (39). The enzyme NE (also known as leukocyte elastase) is a serine protease of neutrophil and monocyte granules, and cleaves many substrates including extracellular matrix proteins, clotting factors, immunoglobulins, and bacterial components, promoting microbe and tissue destruction (40;41). A yeast two-hybrid assay for testing adaptor protein subunit and cargo protein interactions indicates that the μ3A subunit of AP-3 interacts with NE via a tyrosine-based recognition signal, suggesting that NE is an AP-3 cargo protein (36).  The mistrafficking of NE as a result of mutations in either NE (that prevent recognition of the tyrosine-based signal by AP-3) or AP-3 is thought to underlie cyclic neutropenia (42).
 
Putative Mechanism
The bullet gray mutation creates a premature stop codon early in the Ap3b1 sequence (amino acid 421 out of 1105), possibly resulting in degradation of the protein, and at minimum abrogating most protein function.  Thus, the integrity of the AP-3 complex would likely be compromised. In mammals, melanin pigments conferring skin, hair and eye color are tyrosine-derived polymers synthesized in the melanosomes of melanocytes (15).  Incorrect targeting of AP-3 protein cargo, such as the melanin-biosynthetic enzyme tyrosinase (mutated in ghost) to melanosomes, would account for the hypopigmentation of bullet gray animals.  However, the presence of a significant amount of lysosomal membrane proteins in lysosomes of AP-3-deficient cells suggests the existence of an AP-3-independent pathway (18).
 
Genotyping
Bullet gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.  This protocol has not been tested.
 
Primers
bullet gray(F): 5’- ACCCTGGCTTGAAAATGTCCCTTTG -3’
bullet gray(R): 5’- CGACTTCCACGCATGACTAGGAAAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
bullet gray_seq(F): 5’- ACGTTAAGCAATCATTTGGGGC -3’
bullet gray_seq(R): 5’- TATGAAGCAGTGCTTAGTGAATG -3’
 
The following sequence of 621 nucleotides (from Genbank genomic region NC_000079 for linear genomic sequence of Ap3b1) is amplified:
 
91735                                                            accctg
91741 gcttgaaaat gtccctttgc caaagggaca ttaagttata agcgatgaaa gacgttaagc
91801 aatcatttgg ggcccctgtt aggcttaaga gaattctaaa ttttttgtcc tgacaaagct
91861 ataaaaatgg gctttgattc acttgataac gccaatgttg aaactaatca aactgttttt
91921 agacctacgt gagaagccag gacaaacagt ttgcagcagc cactattcag accataggca
91981 gatgtgcaac cagcattagc gaggtcaccg acacatgcct caacggcctg gtctgcctgc
92041 tgtccaacag ggatggtgag ttcataggtt cactttattt ttatatggtt cataattgta
92101 tattctcagt aagtcctata gctgtaatct attatattat cttttcgggt ttttctatat
92161 atcagtattt tctcagtaag tagcagcttt attcttgatt tgcaggaaaa tttatttcaa
92221 aaaataaatg agataattaa tagattttgt tttgctccca ttaagacaat ttatcttact
92281 cattcactaa gcactgcttc ataccctttc tgcaaaggtt ctctgtgact gtttcctagt
92341 catgcgtgga agtcg
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is highlighted in red.
 
References
 15.  Odorizzi, G., Cowles, C. R., and Emr, S. D. (1998) The AP-3 complex: a coat of many colours, Trends Cell Biol. 8, 282-288.
 16.  Huizing, M., Boissy, R. E., and Gahl, W. A. (2002) Hermansky-Pudlak Syndrome: Vesicle Formation from Yeast to Man. Pigment Cell Res. 15, 405-419.
 17.  Oh, J., Bailin, T., Fukai, K., Feng, G. H., Ho, L., Mao, J. I., Frenk, E., Tamura, N., and Spritz, R. A. (1996) Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles, Nat. Genet. 14, 300-306.
 18.  Dell'angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., and Bonifacino, J. S. (1999) Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor, Mol. Cell 3, 11-21.
 19.  Anikster, Y., Huizing, M., White, J., Shevchenko, Y. O., Fitzpatrick, D. L., Touchman, J. W., Compton, J. G., Bale, S. J., Swank, R. T., Gahl, W. A., and Toro, J. R. (2001) Mutation of a new gene causes a unique form of Hermansky-Pudlak syndrome in a genetic isolate of central Puerto Rico, Nat. Genet. 28, 376-380.
 20.  Suzuki, T., Li, W., Zhang, Q., Karim, A., Novak, E. K., Sviderskaya, E. V., Hill, S. P., Bennett, D. C., Levin, A. V., Nieuwenhuis, H. K., Fong, C. T., Castellan, C., Miterski, B., Swank, R. T., and Spritz, R. A. (2002) Hermansky-Pudlak syndrome is caused by mutations in HPS4, the human homolog of the mouse light-ear gene, Nat. Genet. 30, 321-324.
 21.  Zhang, Q., Zhao, B., Li, W., Oiso, N., Novak, E. K., Rusiniak, M. E., Gautam, R., Chintala, S., O'Brien, E. P., Zhang, Y., Roe, B. A., Elliott, R. W., Eicher, E. M., Liang, P., Kratz, C., Legius, E., Spritz, R. A., O'Sullivan, T. N., Copeland, N. G., Jenkins, N. A., and Swank, R. T. (2003) Ru2 and Ru encode mouse orthologs of the genes mutated in human Hermansky-Pudlak syndrome types 5 and 6, Nat. Genet. 33, 145-153.
 22.  Li, W., Zhang, Q., Oiso, N., Novak, E. K., Gautam, R., O'Brien, E. P., Tinsley, C. L., Blake, D. J., Spritz, R. A., Copeland, N. G., Jenkins, N. A., Amato, D., Roe, B. A., Starcevic, M., Dell'angelica, E. C., Elliott, R. W., Mishra, V., Kingsmore, S. F., Paylor, R. E., and Swank, R. T. (2003) Hermansky-Pudlak syndrome type 7 (HPS-7) results from mutant dysbindin, a member of the biogenesis of lysosome-related organelles complex 1 (BLOC-1), Nat. Genet. 35, 84-89.
 23.  Morgan, N. V., Pasha, S., Johnson, C. A., Ainsworth, J. R., Eady, R. A., Dawood, B., McKeown, C., Trembath, R. C., Wilde, J., Watson, S. P., and Maher, E. R. (2006) A germline mutation in BLOC1S3/reduced pigmentation causes a novel variant of Hermansky-Pudlak syndrome (HPS8), Am. J Hum. Genet. 78, 160-166.
 24.  Di Pietro, S. M. and Dell'angelica, E. C. (2005) The cell biology of Hermansky-Pudlak syndrome: recent advances, Traffic. 6, 525-533.
 38.  Lange, R. D. (1983) Cyclic Hematopoiesis: Human Cyclic Neutropenia. Exp. Hematol. 11, 435-451.
 39.  Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A. G., and Dale, D. C. (1999) Mutations in ELA2, Encoding Neutrophil Elastase, Define a 21-Day Biological Clock in Cyclic Haematopoiesis. Nat. Genet. 23, 433-436.
 40.  Doring, G. (1994) The Role of Neutrophil Elastase in Chronic Inflammation. Am. J. Respir. Crit. Care Med. 150, S114-7.
 41.  Belaaouaj, A., McCarthy, R., Baumann, M., Gao, Z., Ley, T. J., Abraham, S. N., and Shapiro, S. D. (1998) Mice Lacking Neutrophil Elastase Reveal Impaired Host Defense Against Gram Negative Bacterial Sepsis. Nat. Med. 4, 615-618.
 42.  Horwitz, M., Benson, K. F., Duan, Z., Li, F. Q., and Person, R. E. (2004) Hereditary Neutropenia: Dogs Explain Human Neutrophil Elastase Mutations. Trends Mol. Med. 10, 163-170.
 
Science Writers
Alyson Mack, Eva Marie Y. Moresco
Authors
Sophie Rutschmann, Bruce Beutler